RMRP


Ribonuclease mitochondrial RNA processing

Ensembl gene entry
Ensembl gene location
Omim gene
Genetics Home Reference entry

Diseases associated to this gene:
CHH

Finnish Mutations

Mutation Consequence Amino acid change Reference sequence Articles
154T 12107819
211G 12107819
262G>T M29916 11207361
70A>G M29916 11207361, 12107819, 16244706
dupTACTCTGTGA at -13 M29916 11207361, 12107819


Foreign Mutations

Mutation Consequence Amino acid change Reference sequence Population Articles
101C>T Belgian 16838329
116A>G American 16838329
118G German 12107819
124C>T American 16838329
146A Chinese 12107819
14G>T American 16838329
152G Canadian 12107819
16-bp dup at +1 Japanese 16832578
168G>A Japanese 16832578
179_180insC American 16838329
180A Mexican 12107819
182C English, Dutch 12107819
182G>A Japanese 14608646
193G>A M29916 English 11207361
2 times dup Swiss 1 ACTACTCTGTGAAGC at -10 Swiss 12107819
211G Polish, American 12107819
214T German 12107819
217C>T Japanese 16832578
218A>G Japanese 14608646
230T Polish 12107819
240A>C Unknown 16630949
243T Canadian 12107819
256_265delCAGCGCGGCT American 16838329
262G>C German 16838329
264A Austrian 12107819
70A>G M29916 French, Canadian, English, Turkish, US Amish, American, Austrian, Irish, Belgian, Dutch 11207361, 12107819, 16244706
79A American 12107819
80G>A American 16838329
89C>G American 16838329
91G>A Belgian 16838329
98dupTG M29916 Canadian, Turkish, Swiss 11207361, 12107819
9T>C German 16838329
Roifman-1 Unknown 16630949
delAG at 94 English 12107819
dup AAGCTGAGGACGTG at 1 American 12107819
dup GAAGCTGAGGACGTGGT at 3 Japanese 14608646
dup GGACGTGGTT at 4 Brazilian 12107819
dup TACTCTGTGAAGCTGAGGAC at -3 Japanese 15780958
dup TCTGTGAAGCTGAGGAC at -3 English 12107819
dup TG at 98 Canadian 12107819
dupAAGCTGAG at -6 Mexican 12107819
dupAAGCTGAGGACG at -2 Unknown 11940090
dupACTACTCTGTGAAGC at -10 M29916 Swiss 11207361
dupTACTCTGTGA at -13 M29916 American 11207361, 12107819
dupTCTGTGAAGCTGAGGAC at -3 M29916 English 11207361
dupTGAAGCTGAG at -6 French 12107819
g.-14_-3dupAAGCTGAGGACG Swiss 16244706
g.-15_-24dupCTACTCTGTG American 16838329
g.-1_-21dupCTCTGTGAAGCTGAGGACGTG American 16838329
g.-20_-14dupTCTGTGA American 16244706
g.-20_-4dupTCTGTGAAGCTGAGGAC Swiss 16244706
g.-22_-10dupACTCTGTGAAGCT French 16244706
g.-23_-14dupTACTCTGTGA French 16244706
g.-23_-15dupTACTCTGTG French 16244706
g.-25_-10tripACTACTCT Italian 16244706
g.-25_-11 dupACTACTCTGTGAAGC Spanish 17015150
g.-25_-11tripACTACTCTGTGAAGC Swiss 16244706
g.-25_-5dupACTACTCTGTGAAGCTGAGGA German 16244706
g.-4_-23dupTACTCTGTGAAGCTGAGGAC German 16838329
g.-6_-25dupACTACTCTGTGAAGCTGAGA Belgian 16838329
g.-8_-1dupAGGACGTG Canadian 16244706
g.126C>T Turkish, Arabian, Italian 12107819, 16244706
g.127G>A Canadian, Italian 16244706
g.146G>C French, Italian 16244706
g.182G>T German 16244706
g.193G>A Canadian, English, German 12107819, 16244706
g.195C>T Swiss, Brazilian, American, Israeli, Italian 12107819, 16244706
g.213C>G German 16244706
g.220T>C German, Italian 16244706
g.238C>T Australian, American, Austrian, Israeli 12107819, 16244706
g.242A>G Canadian, Brazilian 12107819, 16244706
g.244G>A German 16244706
g.248C>T Canadian 16244706
g.254_263delCTCAGCGCGG Spanish/Mexican 17701897
g.260C>G Italian 16244706
g.261C>T Israeli, Trinidadian 12107819
g.35C>T French 16244706
g.40G>A Dutch 16244706
g.45_53dupTGTTCCTCC Dutch 16244706
g.4C>T English, German, Australian, Swiss, Dutch, Italian 12107819, 16244706
g.63C>T French, Australian, Dutch 12107819, 16244706
g.64T>C Italian 16244706
g.68_69delinsTT German 20538026
g.76C>T German 20538026
g.77C>T Unknown 19626344
g.92_93insA Turkish 16244706
g.93G>C Dutch 16244706
g.96_97dupTG Canadian, Swiss 16244706
g.97G>A German 16244706
ins ATCTGTG at -13 Unknown 16630949
ins GGACGTGGTT at -4 American 12107819
ins TCTGTGAAGCTGGGGAC at -20 Japanese 14608646
ins TTCCGCCT at 57 French 12107819
insCCTGAG at -6 German 12107819