COH1


Cohen syndrome protein 1

Ensembl gene entry
Ensembl gene location
Omim gene
Genetics Home Reference entry

Diseases associated to this gene:
COH1

Finnish Mutations

Mutation Consequence Amino acid change Reference sequence Articles
EX20_21del G942_T1027del AY223814 15141358
c.10838_10841delCTCT L3614fsX36 AY223814 15141358
c.3348_3349delCT C1117F...I1124X 12730828
c.5730_5731insA I1913fsX6 AY223814 15141358
c.5827C>T R1943X AY223814 15141358
c.6578T>G L2193R 12730828


Foreign Mutations

Mutation Consequence Amino acid change Reference sequence Population Articles
11598delA frameshift AY223814 French 15173253
1219 C>T Q407X AY223814 Saudi-Arabian 15173253
7221delG frameshift AY223814 Japanese 15173253
7934 G>A G2645D AY223814 Omani 15173253
EX44del L2673_Q2724del AY223814 British 15141358
EX55del V3340fsX9 AY223814 British 15141358
c.10074_10075delCA G3358fs29 Italian 17990063
c.10456_10457delAG L3487fsX25 NM_017890.3 Belgian 16648375
c.10880insTTdelCTGCGAGGCAGCTTGTGCAC T3627_H3633delinsI NM_017890 Unknown 20461111
c.10888C>T Q3630X NM_017890 Turkish 15154116
c.10946G>A W3649X NM_017890.3 German 19006247
c.11125delC T3708fsX61 Italian 17990063
c.11169_11172dupGGAC R3725fsX7 AY223814 British 15141358
c.11216G>A W3739X NM_017890 German 15154116
c.11245G>T E3749X NM_017890.3 Turkish 16648375
c.11314C>T Q3772X NM_017890 German 15154116
c.11556insT V3853fsX32 NM_017890 Unknown 20461111
c.11564_11565delAT Y3855fsX30 NM_017890.3 Turkish 16648375
c.11564delA Y3855fsX22 Italian 17990063
c.11564delA=2 Y3855fsX22 NM_017890 Unknown 20461111
c.11695delAGTG DupEX4-13 S3899fsX42 NM_017890 Unknown 20461111
c.11780delC+c.11783TG>AA T3927fsX15 NM_017890.3 German/English 16648375
c.11906_11915delCCAGCTGTTC P3969fsX41 AY223814 Israeli 15141358
c.11907dupC S3970fsX22 AY223814 British 15141358
c.1269_1273delATTGT C425GfsX8 NM_017890.3 Belgian/Italian 19006247
c.1504C>T R502X NM_017890 Brazilian 15154116
c.1563G>A K521fsX20 NM_017890.3 German/English 16648375
c.1768G>A A590T Italian 17990063
c.2047delC Q721fsX23 Italian 17990063
c.2074C>T R692X NM_017890.3 French 16648375
c.2193C>T R692X Belgian 12730828
c.219_20delACinsT DelEX40-43 K73fsX20 NM_017890 Unknown 20461111
c.22_23delCCinsA P8fsX3 AY223814 Danish 15141358
c.2516_3083del G839_T1027del NM_017890.3 German 16648375
c.2516_4299del G839fsX19 NM_017890.3 Polish 16648375
c.2651-1G>A Splice defect NM_017890.3 Iranian 19006247
c.2727_2730dupGCTC N911fsX3 NM_017890 Polish 15154116
c.2889G>A W963X AY223814 British 15141358
c.2911C>T R971X NM_017890 Turkish 15154116
c.2934+1_2934+2delGT G942fsX14 NM_017890.3 German 16648375
c.3427C>T R1143X Italian 17990063
c.3427C>T=2 DelEX32-35 R1143X NM_017890 Unknown 20461111
c.3618T>A C1206X NM_017890 German 15154116
c.402insT DupEX20-30 L135fsX10 NM_017890 Unknown 20461111
c.413_2013del G138EfsX4 NM_017890.3 Iranian 19006247
c.4334delA Q1445fsX7 AY223814 British 15141358
c.4396insA T1466fsX5 NM_017890 German 15154116
c.4411C>T R1471X NM_017890.3 Dutch 19006247
c.4471G>T E1491X AY223814 British 15141358
c.4474delA I1492fsX42 NM_017890 Unknown 20461111
c.4478_4480delTTC L1494del NM_017890.3 Iranian 19006247
c.4572_4573insA E1525R...E1569X British 12730828
c.463_466delATAA N156fsX4 AY223814 British 15141358
c.4820+2T>C Splice defect NM_017890.3 Albanian/German 19006247
c.4877_4879dupAAT Y1627X NM_017890.3 Turkish 16648375
c.4923G>A W1641X NM_017890.3 German 16648375
c.4955C>G S1652X NM_017890.3 German 16648375
c.5069T>A L1690X NM_017890 German 15154116
c.5152_5295del E1718_E1765del NM_017890.3 Polish 16648375
c.5215_5232delAGTGTGGCTCAAGTTCAA S1739_Q1744del NM_017890.3 German 16648375
c.5331insT DupEX57-60 D1778X NM_017890 Unknown 20461111
c.5426_5427dupAG Q1810S...K1830X Belgian 12730828
c.5461_5462insC R1821fsX18 NM_017890.3 French 16648375
c.5613_5614insT S1873fsX9 AY223814 British 15141358
c.5750delC S1917fsX19 AY223814 British 15141358
c.5808-5809delTA frameshift Japanese 15691367
c.5920C>T R1974X NM_017890.3 Polish 16648375
c.625_626delAC T209SfsX4 NM_017890.3 Belgian/Italian 19006247
c.6420_6421delGA Q2140H...L2167X Danish 12730828
c.6687delA Q2229HfsX10 NM_017890.3 German 19006247
c.6732 1G>A AY223814 Israeli 15141358
c.6733-2A>G AY223814 American 15141358
c.7022A>G Y2341C NM_017890 German 15154116
c.7051C>T R2351X Belgian 12730828
c.7153G>T E2384X NM_017890.3 French 16648375
c.7322_7322+1delGGinsATGGAGC S2441fsX37 NM_017890.3 French 16648375
c.7504+1G>A Italian 17990063
c.7603C>T R2535X NM_017890 German 15154116
c.7610G>A W2537X NM_017890 German 15154116
c.7934G>A G2645D NM_017890 Omani 15154116
c.7935delC Q2646fsX96 NM_017890 Polish 15154116
c.8119C>T R2707X Italian 17990063
c.8292C>A C2764X NM_017890.3 Turkish 16648375
c.8318C>T S2773L NM_017890.3 Turkish 16648375
c.8341delC L2781X AY223814 Danish 15141358
c.8459T>C I2820T Ohio Amish 15211651
c.8472G>A W2824X British 12730828
c.8515C>T R2839X NM_017890.3 French 19006247
c.8609delA E2870fsX16 NM_017890 German 15154116
c.8697-2A>G E2900fsX2 AY223814 Dutch 15141358
c.8978A>G N2993S AY223814 Belgian 15141358
c.916_917delGA D306YfsX9 NM_017890.3 Belgian 19006247
c.9258_9259insT frameshift Ohio Amish 15211651
c.9406-1G>T Y3136fsX16 NM_017890 Lebanese 15154116
c.9690-2A>G R3230fsX20 AY223814 British 15141358
c.9706delT Y3236IfsX7 NM_017890.3 Belgian 19006247
c.9731delA Y3244fsX7 NM_017890 German 15154116
c.EX30del A1570G?A1573X British 12730828
del EX6-EX16 Greek 18655112
del promotor-EX8 NM_152564 Unknown 19533689
delEX17-21 NM_152564 Unknown 19533689
delEX18-19 NM_152564 Unknown 19533689
delEX4-16 NM_152564 Unknown 19533689
delEX40-43 NM_152564 Unknown 19533689
delEX46-50 NM_017890 Unknown 20461111