All FinDis Variants

This page lists all variants for all FinDis diseases.
For gene-specific listings, see the Genes page.

Download all FinDis variants in tab-separated format
Build: hg19            This page last updated: 2013-07-05
GeneNameCHRStart positionEnd positionRef_alleleVar_alleleOMIMDiseasesPopulations
PPT1NM_000310.3:c.*526_*529delATCA14053920440539207TGAT-256730Ceroid lipofuscinosis, neuronal, 1French
PPT1NM_000310.3:c.914T>C14053974040539740AG256730Ceroid lipofuscinosis, neuronal, 1Finnish
PPT1NM_000310.3:c.888G>A14053976640539766CT256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.886T>C14053976840539768AG256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.871C>T14053978340539783GA256730Ceroid lipofuscinosis, neuronal, 1African-American
PPT1NM_000310.3:c.774dupA14054253840542538TTT256730Ceroid lipofuscinosis, neuronal, 1French
PPT1NM_000310.3:c.749G>T14054256340542563CA256730Ceroid lipofuscinosis, neuronal, 1German
PPT1NM_000310.3:c.739T>C14054257340542573AG256730Ceroid lipofuscinosis, neuronal, 1German/Native American
PPT1NM_000310.3:c.727-2A>T14054258740542587TA256730Ceroid lipofuscinosis, neuronal, 1European
PPT1NM_000310.3:c.683T>G14054427540544275AC256730Ceroid lipofuscinosis, neuronal, 1Dutch
PPT1NM_000310.3:c.674T>C14054428440544284AG256730Ceroid lipofuscinosis, neuronal, 1American
PPT1NM_000310.3:c.665T>C14054429340544293AG256730Ceroid lipofuscinosis, neuronal, 1Italian
PPT1NM_000310.3:c.656T>A14054430240544302AT256730Ceroid lipofuscinosis, neuronal, 1Belgian
PPT1NM_000310.3:c.644delA14054431440544314T-256730Ceroid lipofuscinosis, neuronal, 1
PPT1NM_000310.3:c.628-1G>T14054433140544331CA256730Ceroid lipofuscinosis, neuronal, 1European; American
PPT1NM_000310.3:c.566C>G14054613040546130GC256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.560A>G14054613640546136TC256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.558G>A14054613840546138CT256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.550G>A14054614640546146CT256730Ceroid lipofuscinosis, neuronal, 1European; Chinese
PPT1NM_000310.3:c.544C>T14054615240546152GA256730Ceroid lipofuscinosis, neuronal, 1Dutch
PPT1NM_000310.3:c.541G>T14054615540546155CA256730Ceroid lipofuscinosis, neuronal, 1Spanish
PPT1NM_000310.3:c.541G>A14054615540546155CT256730Ceroid lipofuscinosis, neuronal, 1European; Canadian
PPT1NM_000310.3:c.538dupC14054615840546158GGG256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.536+2T>C14055508040555080AG256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.536+1G>A14055508140555081CT256730Ceroid lipofuscinosis, neuronal, 1American
PPT1NM_000310.3:c.529C>G14055508940555089GC256730Ceroid lipofuscinosis, neuronal, 1English; German
PPT1NM_000310.3:c.490C>T14055512840555128GA256730Ceroid lipofuscinosis, neuronal, 1Dutch; Arab/Moroccan
PPT1NM_000310.3:c.456C>A14055516240555162GT256730Ceroid lipofuscinosis, neuronal, 1Japanese
PPT1NM_000310.3:c.455G>A14055516340555163CT256730Ceroid lipofuscinosis, neuronal, 1Finnish; Swedish
PPT1NM_000310.3:c.451C>T14055516740555167GA256730Ceroid lipofuscinosis, neuronal, 1European;Russian;Brazilian; American
PPT1NM_000310.3:c.413C>T14055702140557021GA256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.401T>C14055703340557033AG256730Ceroid lipofuscinosis, neuronal, 1Turkish; Canadian
PPT1NM_000310.3:c.398delT14055703640557036A-256730Ceroid lipofuscinosis, neuronal, 1European
PPT1NM_000310.3:c.364A>T14055707040557070TA256730Ceroid lipofuscinosis, neuronal, 1Finnish; European
PPT1NM_000310.3:c.363-3T>G14055707440557074AC256730Ceroid lipofuscinosis, neuronal, 1Brazilian
PPT1NM_000310.3:c.363-4G>A14055707540557075CT256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.353G>A14055772640557726CT256730Ceroid lipofuscinosis, neuronal, 1Irish/Norwegian
PPT1NM_000310.3:c.325T>G14055775440557754AC256730Ceroid lipofuscinosis, neuronal, 1Norwegian/Canadian/Cherokee; English
PPT1NM_000310.3:c.322G>C14055775740557757CG256730Ceroid lipofuscinosis, neuronal, 1French; Dutch
PPT1NM_000310.3:c.310A>T14055776940557769TA256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.287G>A14055779240557792CT256730Ceroid lipofuscinosis, neuronal, 1Dutch; English
PPT1NM_000310.3:c.271_287delCAAGTAACAACAGTGTGinsTT14055779240557808CACACTGTTGTTACTTGAA256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.272A>C14055780740557807TG256730Ceroid lipofuscinosis, neuronal, 1Chinese
PPT1NM_000310.3:c.255_257delCTT14055782240557824AAG-256730Ceroid lipofuscinosis, neuronal, 1European; American
PPT1NM_000310.3:c.236A>G14055784340557843TC256730Ceroid lipofuscinosis, neuronal, 1European; American
PPT1NM_000310.3:c.235-3T>C14055784740557847AG256730Ceroid lipofuscinosis, neuronal, 1Italian
PPT1NM_000310.3:c.124+1215_235-102del362714055794640561572256730Ceroid lipofuscinosis, neuronal, 1Italian
PPT1NM_000310.3:c.223A>C14055808140558081TG256730Ceroid lipofuscinosis, neuronal, 1
PPT1NM_000310.3:c.175delG14055812940558129C-256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.169dupA14055813540558135TTT256730Ceroid lipofuscinosis, neuronal, 1American; Russian
PPT1NM_000310.3:c.163A>T14055814140558141TA256730Ceroid lipofuscinosis, neuronal, 1Scottish
PPT1NM_000310.3:c.134G>A14055817040558170CT256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.132_133insTGT14055817140558172AGAACAG256730Ceroid lipofuscinosis, neuronal, 1Afro-Caribbean/Asian; English
PPT1NM_000310.3:c.125G>A14055817940558179CT256730Ceroid lipofuscinosis, neuronal, 1Swedish/Norwegian
PPT1NM_000310.3:c.125-2A>G14055818140558181TC256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.125-15T>G14055819440558194AC256730Ceroid lipofuscinosis, neuronal, 1Italian
PPT1NM_000310.3:c.124+1G>A14056278640562786CT256730Ceroid lipofuscinosis, neuronal, 1Chinese
PPT1NM_000310.3:c.117T>A14056279440562794AT256730Ceroid lipofuscinosis, neuronal, 1European
PPT1NM_000310.3:c.114delG14056279740562797C-256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.114G>T14056279740562797CA256730Ceroid lipofuscinosis, neuronal, 1Turkish
PPT1NM_000310.3:c.114G>A14056279740562797CT256730Ceroid lipofuscinosis, neuronal, 1English
PPT1NM_000310.3:c.29T>A14056288240562882AT256730Ceroid lipofuscinosis, neuronal, 1European/Canadian/Cherokee;Scottish;English; Canadian
PPT1NM_000310.3:c.3G>A14056290840562908CT256730Ceroid lipofuscinosis, neuronal, 1European;German/Native American
PPT1NM_000310.3:c.-83G>A14056299340562993CT256730Ceroid lipofuscinosis, neuronal, 1American
PPT1NM_000310.3:c.-109C>A14056301940563019GT256730Ceroid lipofuscinosis, neuronal, 1Dutch; American
POMGNT1NM_017739.3:c.1539+261_*2405del14665253746657509253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Algerian
POMGNT1NM_017739.3:c.1539+184_*2354del14665258846657586253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Tunisian
POMGNT1NM_017739.3:c.1928delT14665499946654999A-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American/Japanese
POMGNT1NM_017739.3:c.1896-1G>C14665503046655030CG253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Chinese
POMGNT1NM_017739.3:c.1895+1_4delGTGA14665512646655129TCAC-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Spanish
POMGNT1NM_017739.3:c.1895+1G>T14665512946655129CA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; Italian
POMGNT1NM_017739.3:c.1895+1G>A14665512946655129CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American
POMGNT1NM_017739.3:c.1876delG14665514946655149C-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3French
POMGNT1NM_017739.3:c.1864delC14665516146655161G-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.1814G>C14665521146655211CG253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Turkish
POMGNT1NM_017739.3:c.1814G>A14665521146655211CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.1785+2T>G14665552446655524AC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.1769G>A14665554246655542CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American
POMGNT1NM_017739.3:c.1738C>T14665557346655573GA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.1719delC14665559246655592G-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Turkish
POMGNT1NM_017739.3:c.1649G>A14665614546656145CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Turkish
POMGNT1NM_017739.3:c.1540-2A>G14665645846656458TC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Turkish
POMGNT1NM_017739.3:c.1539+1G>T14665776946657769CA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Finnish; Turkish
POMGNT1NM_017739.3:c.1539+1G>A14665776946657769CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; Belgian
POMGNT1NM_017739.3:c.1478C>G14665783146657831GC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3French
POMGNT1NM_017739.3:c.1469G>A14665784046657840CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; French
POMGNT1NM_017739.3:c.1425G>A14665788446657884CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.1350_1354delCTGGG14665803946658043CCCAG-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Turkish
POMGNT1NM_017739.3:c.1342G>C14665805146658051CG253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Algerian
POMGNT1NM_017739.3:c.1325G>A14665806846658068CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Turkish
POMGNT1NM_017739.3:c.1324C>T14665806946658069GA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; German
POMGNT1NM_017739.3:c.1319T>G14665807446658074AC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Chinese
POMGNT1NM_017739.3:c.1285-2A>G14665811046658110TC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.1274G>C14665820046658200CG253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Spanish
POMGNT1NM_017739.3:c.1100G>A14665898746658987CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.982dupG14665928046659280CCC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Japanese
POMGNT1NM_017739.3:c.932G>A14665954546659545CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; French
POMGNT1NM_017739.3:c.931C>T14665954646659546GA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.879+5G>A14665994146659941CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Swedish
POMGNT1NM_017739.3:c.879+5G>T14665994146659941CA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Finnish
POMGNT1NM_017739.3:c.806G>A14666001946660019CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Japanese
POMGNT1NM_017739.3:c.794G>A14666003146660031CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; French
POMGNT1NM_017739.3:c.-50-?_751+?del14666022546663543253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.667G>A14666030946660309CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Japanese; Belgian
POMGNT1NM_017739.3:c.652+1G>A14666051546660515CT253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.643C>T14666052546660525GA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.636C>T14666053246660532GA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3French
POMGNT1NM_017739.3:c.630G>T14666053846660538CA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3French
POMGNT1NM_017739.3:c.594C>G14666057446660574GC253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.593delG14666057546660575C-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3American; German
POMGNT1NM_017739.3:c.526A>C14666149146661491TG253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3
POMGNT1NM_017739.3:c.421-29_452del6114666156546661625253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3French
POMGNT1NM_017739.3:c.447delT14666157046661570A-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Japanese
POMGNT1NM_017739.3:c.351delC14666240646662406G-253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.187C>T14666247646662476GA253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3Italian
POMGNT1NM_017739.3:c.25dupC14666346946663469GGG253280Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type A, 3German
FSHRNM_000145.3:c.668+4941_*147473del24904239949205110233300Ovarian dysgenesis 1
FSHRNM_000145.3:c.1801C>G24919015949190159GC233300Ovarian dysgenesis 1Caucasian
FSHRNM_000145.3:c.1760C>A24919020049190200GT233300Ovarian dysgenesis 1
FSHRNM_000145.3:c.1724C>T24919023649190236GA233300Ovarian dysgenesis 1Indian
FSHRNM_000145.3:c.1717C>T24919024349190243GA233300Ovarian dysgenesis 1Armenian
FSHRNM_000145.3:c.1555C>A24919040549190405GT233300Ovarian dysgenesis 1Caucasian
FSHRNM_000145.3:c.1255G>A24919070549190705CT233300Ovarian dysgenesis 1Finnish
FSHRNM_000145.3:c.1043C>G24919091749190917GC233300Ovarian dysgenesis 1
FSHRNM_000145.3:c.671A>T24919602049196020TA233300Ovarian dysgenesis 1Caucasian
FSHRNM_000145.3:c.662T>G24921005749210057AC233300Ovarian dysgenesis 1Japanese
FSHRNM_000145.3:c.566C>T24921026449210264GA233300Ovarian dysgenesis 1Finnish
FSHRNM_000145.3:c.479T>C24921616149216161AG233300Ovarian dysgenesis 1Armenian
LCTNM_002299.2:c.5387delA2136547317136547317T-223000Lactase deficiency, congenitalJapanese
LCTNM_002299.2:c.4998_5001delTGAG2136552321136552324CTCA-223000Lactase deficiency, congenitalFinnish
LCTNM_002299.2:c.4834G>T2136558209136558209CA223000Lactase deficiency, congenitalItalian
LCTNM_002299.2:c.4760G>A2136558283136558283CT223000Lactase deficiency, congenitalFinnish
LCTNM_002299.2:c.4419C>G2136562382136562382GC223000Lactase deficiency, congenitalJapanese
LCTNM_002299.2:c.4170T>A2136564701136564701AT223000Lactase deficiency, congenitalFinnish
LCTNM_002299.2:c.4087G>A2136564784136564784CT223000Lactase deficiency, congenitalFinnish
LCTNM_002299.2:c.2062T>C2136570172136570172AG223000Lactase deficiency, congenitalItalian
LCTNM_002299.2:c.1692_1696delAGTGG2136574922136574926CCACT-223000Lactase deficiency, congenitalFinnish
LCTNM_002299.2:c.804G>C2136587163136587163CG223000Lactase deficiency, congenitalFinnish
LCTNM_002299.2:c.653_654delCT2136590747136590748AG-223000Lactase deficiency, congenitalFinnish
TTNNM_001267550.1:c.107890C>T2179391825179391825GA600334Tibial muscular dystrophy, tardiveFrench
TTNNM_001267550.1:c.107889delA2179391826179391826T-600334Tibial muscular dystrophy, tardiveSpanish
TTNNM_001267550.1:c.107867T>C2179391848179391848AG600334Tibial muscular dystrophy, tardiveFrench
TTNNM_001267550.1:c.107840T>C2179391875179391875AG600334Tibial muscular dystrophy, tardiveBelgian
TTNNM_001267550.1:c.107837A>C2179391878179391878TG600334Tibial muscular dystrophy, tardiveItalian
TTNNM_001267550.1:c.107780_107790delAAGTAACATGGinsTGAAAGAAAAA2179391925179391935CCATGTTACTTTTTTTCTTTCA600334Tibial muscular dystrophy, tardiveFinnish
TTNNM_001267550.1:c.107647delT2179392206179392206A-600334Tibial muscular dystrophy, tardiveFrench
BCS1LNM_004328.4:c.-50+155T>A2219525123219525123TA603358GRACILE syndromeBritish
BCS1LNM_004328.4:c.166C>T2219525876219525876CT603358GRACILE syndromeBritish
BCS1LNM_004328.4:c.232A>G2219525942219525942AG603358GRACILE syndromeFinnish; English
BCS1LNM_004328.4:c.320+1G>T2219526031219526031GT603358GRACILE syndromeBritish
BCS1LNM_004328.4:c.431G>A2219526239219526239GA603358GRACILE syndromeBritish
BCS1LNM_004328.4:c.980T>C2219527696219527696TC603358GRACILE syndromeBritish
AMTNM_000481.3:c.982_983delGCinsT34945530149455302GCA605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.970_972delATG34945531249455314CAT-605899Glycine encephalopathyOriental
AMTNM_000481.3:c.959G>A34945532549455325CT605899Glycine encephalopathy
AMTNM_000481.3:c.887G>A34945539749455397CT605899Glycine encephalopathy
AMTNM_000481.3:c.878-1G>A34945540749455407CT605899Glycine encephalopathy
AMTNM_000481.3:c.826G>C34945645549456455CG605899Glycine encephalopathy
AMTNM_000481.3:c.806G>A34945647549456475CT605899Glycine encephalopathy
AMTNM_000481.3:c.674A>G34945671549456715TC605899Glycine encephalopathy
AMTNM_000481.3:c.635T>C34945675449456754AG605899Glycine encephalopathy
AMTNM_000481.3:c.574C>T34945681549456815GA605899Glycine encephalopathy
AMTNM_000481.3:c.535delC34945715849457158G-605899Glycine encephalopathyOriental
AMTNM_000481.3:c.471+2T>C34945764249457642AG605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.452_466delAAGATTTGGCCCTCA34945764949457663TGAGGGCCAAATCTT-605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.434A>T34945768149457681TA605899Glycine encephalopathyCaucasian/Native American
AMTNM_000481.3:c.259-1G>C34945900649459006CG605899Glycine encephalopathy
AMTNM_000481.3:c.230C>T34945956549459565GA605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.217C>T34945957849459578GA605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.212A>C34945958349459583TG605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.148delG34945964749459647C-605899Glycine encephalopathyOriental
AMTNM_000481.3:c.139G>T34945965649459656CA605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.139G>A34945965649459656CT605899Glycine encephalopathy
AMTNM_000481.3:c.125A>G34945967049459670TC605899Glycine encephalopathyIsraeli-Arab
AMTNM_000481.3:c.63delC34945982149459821G-605899Glycine encephalopathyOriental
AMTNM_000481.3:c.61delG34945982349459823C-605899Glycine encephalopathyCaucasian
AMTNM_000481.3:c.59delC34945982549459825G-605899Glycine encephalopathyJapanese
AMTNM_000481.3:c.-55C>T34945993849459938GA605899Glycine encephalopathy
CLRN1NM_174878.2:c.528T>G3150645894150645894AC276902Usher syndrome, type 3AFinnish
CLRN1NM_174878.2:c.359T>A3150659443150659443AT276902Usher syndrome, type 3AFinnish
CLRN1NM_174878.2:c.144T>G3150690352150690352AC276902Usher syndrome, type 3AFinnish
CC2D2ANM_001080522.2:c.517C>T41551184015511840CT612284Meckel syndrome 6Mauritanian
CC2D2ANM_001080522.2:c.685_687delGAA41551301415513016GAA-612284Meckel syndrome 6British
CC2D2ANM_001080522.2:c.834delG41551644615516446G-612284Meckel syndrome 6American
CC2D2ANM_001080522.2:c.1339delG41552925915529259G-612284Meckel syndrome 6
CC2D2ANM_001080522.2:c.1537T>A41553488615534886TA612284Meckel syndrome 6French
CC2D2ANM_001080522.2:c.1762C>T41553869715538697CT612284Meckel syndrome 6Finnish; European
CC2D2ANM_001080522.2:c.2486+1G>C41555492915554929GC612284Meckel syndrome 6French
CC2D2ANM_001080522.2:c.2773C>T41555907415559074CT612284Meckel syndrome 6French
CC2D2ANM_001080522.2:c.3084delG41556504715565047G-612284Meckel syndrome 6European; Turkish
CC2D2ANM_001080522.2:c.3145C>G41556510815565108CG612284Meckel syndrome 6Guadeloupean
CC2D2ANM_001080522.2:c.3289delG41556930015569300G-612284Meckel syndrome 6European
CC2D2ANM_001080522.2:c.3341C>T41556935215569352CT612284Meckel syndrome 6European
CC2D2ANM_001080522.2:c.3399-3C>A41557091315570913CA612284Meckel syndrome 6French
CC2D2ANM_001080522.2:c.3399_3975del41557091615581794612284Meckel syndrome 6Algerian
CC2D2ANM_001080522.2:c.3522_3523insTG41557204715572048CCCTGC612284Meckel syndrome 6French
CC2D2ANM_001080522.2:c.3544T>C41557206915572069TC612284Meckel syndrome 6British
CC2D2ANM_001080522.2:c.3584delT41557210915572109T-612284Meckel syndrome 6Turkish
CC2D2ANM_001080522.2:c.3774dupT41558159315581593TTT612284Meckel syndrome 6British
CC2D2ANM_001080522.2:c.3893T>A41558171215581712TA612284Meckel syndrome 6British
CC2D2ANM_001080522.2:c.3975_3975+3delAGTA41558179415581797AGTA-612284Meckel syndrome 6European
CC2D2ANM_001080522.2:c.4179delG41558955215589552G-612284Meckel syndrome 6European
CC2D2ANM_001080522.2:c.4179+1delG41558955315589553G-612284Meckel syndrome 6French
CC2D2ANM_001080522.2:c.4496+2T>A41559909015599090TA612284Meckel syndrome 6French
AGANM_000027.3:c.941-148_*1920del4178350942178353110208400AspartylglucosaminuriaNorth American
AGANM_000027.3:c.1000G>T4178352903178352903CA208400AspartylglucosaminuriaItalian
AGANM_000027.3:c.940+1G>T4178354367178354367CA208400AspartylglucosaminuriaAfrican-American
AGANM_000027.3:c.916T>C4178354392178354392AG208400AspartylglucosaminuriaAmerican
AGANM_000027.3:c.904G>A4178354404178354404CT208400AspartylglucosaminuriaTurkish
AGANM_000027.3:c.800dupT4178355542178355542AAA208400AspartylglucosaminuriaSpanish-American
AGANM_000027.3:c.788delT4178355554178355554A-208400AspartylglucosaminuriaMauritanian
AGANM_000027.3:c.770C>T4178355572178355572GA208400AspartylglucosaminuriaFinnish
AGANM_000027.3:c.755G>A4178355587178355587CT208400AspartylglucosaminuriaFinnish
AGANM_000027.3:c.754G>C4178355588178355588CG208400AspartylglucosaminuriaItalian
AGANM_000027.3:c.677G>A4178357451178357451CT208400AspartylglucosaminuriaCanadian
AGANM_000027.3:c.503G>A4178359903178359903CT208400AspartylglucosaminuriaBritish
AGANM_000027.3:c.488G>C4178359918178359918CG208400AspartylglucosaminuriaFinnish
AGANM_000027.3:c.482G>A4178359924178359924CT208400AspartylglucosaminuriaFinnish
AGANM_000027.3:c.439T>C4178359967178359967AG208400AspartylglucosaminuriaQatar
AGANM_000027.3:c.404T>C4178360002178360002AG208400AspartylglucosaminuriaCanadian
AGANM_000027.3:c.395-8A>G4178360019178360019TC208400AspartylglucosaminuriaJapanese
AGANM_000027.3:c.373_376delACAC4178360748178360751GTGT-208400AspartylglucosaminuriaPakistani
AGANM_000027.3:c.369_373delACACA4178360753178360757TGTGT-208400AspartylglucosaminuriaAmerican
AGANM_000027.3:c.346C>T4178360778178360778GA208400AspartylglucosaminuriaTurkish
AGANM_000027.3:c.336delT4178360788178360788A-208400AspartylglucosaminuriaDutch
AGANM_000027.3:c.302C>T4178360822178360822GA208400AspartylglucosaminuriaItalian; English
AGANM_000027.3:c.299G>A4178360825178360825CT208400AspartylglucosaminuriaCanadian
AGANM_000027.3:c.214T>C4178361494178361494AG208400AspartylglucosaminuriaArab
AGANM_000027.3:c.200_201delAG4178361507178361508CT-208400AspartylglucosaminuriaFinnish
AGANM_000027.3:c.192T>A4178361516178361516AT208400AspartylglucosaminuriaPuerto Rican
AGANM_000027.3:c.179G>A4178361529178361529CT208400AspartylglucosaminuriaGerman
AGANM_000027.3:c.127_127+1insATGCGG4178363402178363403GGGCCGCATG208400AspartylglucosaminuriaTunisian
AGANM_000027.3:c.102_108delGCCCTTT4178363422178363428AAAGGGC-208400AspartylglucosaminuriaEnglish
AGANM_000027.3:c.44T>G4178363486178363486AC208400AspartylglucosaminuriaFinnish
SLC26A2NM_000112.3:c.-26+2T>C5149340544149340544TC222600Diastrophic dysplasiaFinnish; non-Finnish
SLC26A2NM_000112.3:c.47C>G5149357262149357262CG222600Diastrophic dysplasiaItalian
SLC26A2NM_000112.3:c.55G>T5149357270149357270GT222600Diastrophic dysplasiaBritish-Australian
SLC26A2NM_000112.3:c.229A>C5149357444149357444AC222600Diastrophic dysplasiaFrench
SLC26A2NM_000112.3:c.255delC5149357470149357470C-222600Diastrophic dysplasiaFrench
SLC26A2NM_000112.3:c.331G>T5149357546149357546GT222600Diastrophic dysplasiaGerman
SLC26A2NM_000112.3:c.403C>A5149357618149357618CA222600Diastrophic dysplasiaFrench
SLC26A2NM_000112.3:c.496G>A5149357711149357711GA222600Diastrophic dysplasiaSpanish
SLC26A2NM_000112.3:c.532C>T5149357747149357747CT222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.705_711delGATGGGC5149359861149359867GATGGGC-222600Diastrophic dysplasiaHispanic-American
SLC26A2NM_000112.3:c.700-1G>C5149359882149359882GC222600Diastrophic dysplasiaAmerican; Portugese
SLC26A2NM_000112.3:c.764G>A5149359920149359920GA222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.835C>T5149359991149359991CT222600Diastrophic dysplasiaCaucasian; Finnish
SLC26A2NM_000112.3:c.906_907delCT5149360062149360063CT-222600Diastrophic dysplasiaFrench
SLC26A2NM_000112.3:c.1018_1020delGTT5149360174149360176GTT-222600Diastrophic dysplasiaFinnish; Japanese
SLC26A2NM_000112.3:c.1157C>T5149360313149360313CT222600Diastrophic dysplasiaLebanese
SLC26A2NM_000112.3:c.1242_1245delAAAC5149360398149360401AAAC-222600Diastrophic dysplasiaGerman
SLC26A2NM_000112.3:c.1273A>G5149360429149360429AG222600Diastrophic dysplasiaPortugese
SLC26A2NM_000112.3:c.1361A>C5149360517149360517AC222600Diastrophic dysplasiaLebanese
SLC26A2NM_000112.3:c.1394delT5149360550149360550T-222600Diastrophic dysplasiaBelgian
SLC26A2NM_000112.3:c.1451G>A5149360607149360607GA222600Diastrophic dysplasiaCzech
SLC26A2NM_000112.3:c.1474C>T5149360630149360630CT222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.1535C>A5149360691149360691CA222600Diastrophic dysplasiaFinnish
SLC26A2NM_000112.3:c.1650delG5149360806149360806G-222600Diastrophic dysplasiaEuropean
SLC26A2NM_000112.3:c.1721T>C5149360877149360877TC222600Diastrophic dysplasiaGerman; Dutch
SLC26A2NM_000112.3:c.1724delA5149360880149360880A-222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.1957T>A5149361113149361113TA222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.1976delT5149361132149361132T-222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.1983delA5149361139149361139A-222600Diastrophic dysplasia
SLC26A2NM_000112.3:c.1994A>C5149361150149361150AC222600Diastrophic dysplasiaCanadian-British
SLC26A2NM_000112.3:c.2120_2121delTT5149361276149361277TT-222600Diastrophic dysplasiaFrench
TREM2NM_018965.2:c.558G>T64112672941126729CT221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyNorwegian
TREM2NM_018965.2:c.482+2T>C64112752841127528AG221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyItalian; Japanese
TREM2NM_018965.2:c.401A>G64112761141127611TC221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyAmerican
TREM2NM_018965.2:c.377T>G64112901541129015AC221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyCanadian
TREM2NM_018965.2:c.313delG64112907941129079C-221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyGerman
TREM2NM_018965.2:c.269delG64112912341129123C-221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyFrench
TREM2NM_018965.2:c.233G>A64112915941129159CT221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathySwedish
TREM2NM_018965.2:c.132G>A64112926041129260CT221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyBolivian
TREM2NM_018965.2:c.97C>T64112929541129295GA221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyItalian; Belgian
TREM2NM_018965.2:c.40+3_40+5delAGG64113077641130778CCT-221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyLebanese Maronite
TREM2NM_018965.2:c.40G>T64113078141130781CA221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyGerman
SLC17A5NM_012434.4:c.1226G>A67432015674320156CT604369Sialuria, Finnish type (Salla disease)Caucasian
SLC17A5NM_012434.4:c.1138_1139delGT67432024374320244AC-604369Sialuria, Finnish type (Salla disease)British
SLC17A5NM_012434.4:c.1007_1008delTA67432514174325142TA-604369Sialuria, Finnish type (Salla disease)Finnish; Swedish
SLC17A5NM_012434.4:c.983G>A67432516674325166CT604369Sialuria, Finnish type (Salla disease)Bedouin
SLC17A5NM_012434.4:c.526_819del67434510574348221604369Sialuria, Finnish type (Salla disease)Finnish
SLC17A5NM_012434.4:c.802_816del67434510874345122604369Sialuria, Finnish type (Salla disease)Italian
SLC17A5NM_012434.4:c.719G>A67434520574345205CT604369Sialuria, Finnish type (Salla disease)Finnish
SLC17A5NM_012434.4:c.292_613del67434813574351647604369Sialuria, Finnish type (Salla disease)German
SLC17A5NM_012434.4:c.507delA67435143274351432T-604369Sialuria, Finnish type (Salla disease)Finnish
SLC17A5NM_012434.4:c.406A>G67435153374351533TC604369Sialuria, Finnish type (Salla disease)Finnish; Italian
SLC17A5NM_012434.4:c.309G>A67435163074351630CT604369Sialuria, Finnish type (Salla disease)Swedish
SLC17A5NM_012434.4:c.291G>A67435413074354130CT604369Sialuria, Finnish type (Salla disease)Caucasian
SLC17A5NM_012434.4:c.115C>T67435430674354306GA604369Sialuria, Finnish type (Salla disease)Finnish;Swedish;Italian;Dutch;German;American;British;Old Order Mennonites
SLC17A5NM_012434.4:c.95-1G>C67435432774354327CG604369Sialuria, Finnish type (Salla disease)Swedish
SLC26A3NM_000111.2:c.2205+3A>G7107408208107408208TC214700Chloride diarrhea, congenital, Finnish typeSwedish
SLC26A3NM_000111.2:c.2132T>G7107408284107408284AC214700Chloride diarrhea, congenital, Finnish typeTyrolean
SLC26A3NM_000111.2:c.2116delA7107408300107408300T-214700Chloride diarrhea, congenital, Finnish typeFinnish
SLC26A3NM_000111.2:c.2104_2105delGGinsACCGGTTTTGAAGTGAAAATTCAAAATTT7107408311107408312CCAAATTTTGAATTTTCACTTCAAAACCGGT214700Chloride diarrhea, congenital, Finnish typeNorwegian
SLC26A3NM_000111.2:c.2063-1G>T7107408354107408354CA214700Chloride diarrhea, congenital, Finnish typeKorean
SLC26A3NM_000111.2:c.2024_2026dupTCA7107412535107412537TGATGATGA214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1990delG7107414382107414382C-214700Chloride diarrhea, congenital, Finnish typeSwedish
SLC26A3NM_000111.2:c.1954G>A7107414418107414418CT214700Chloride diarrhea, congenital, Finnish typeTurkish; German
SLC26A3NM_000111.2:c.1631T>A7107416943107416943AT214700Chloride diarrhea, congenital, Finnish typeVietnamese
SLC26A3NM_000111.2:c.1624_1626delTCTinsC7107416948107416950TCTC214700Chloride diarrhea, congenital, Finnish typeTurkish
SLC26A3NM_000111.2:c.1609delA7107416965107416965A-214700Chloride diarrhea, congenital, Finnish typeNorth American/Canadian
SLC26A3NM_000111.2:c.1579_1581delTAT7107417085107417087ATA-214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1563G>C7107417103107417103CG214700Chloride diarrhea, congenital, Finnish typeSwedish
SLC26A3NM_000111.2:c.1559A>G7107417107107417107TC214700Chloride diarrhea, congenital, Finnish typeTurkish
SLC26A3NM_000111.2:c.1551_1554delCAAC7107417112107417115GTTG-214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1526_1527delGC7107417139107417140GC-214700Chloride diarrhea, congenital, Finnish typeJapanese
SLC26A3NM_000111.2:c.1517delC7107417149107417149G-214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1515-2delA7107417153107417153T-214700Chloride diarrhea, congenital, Finnish typeKuwaiti
SLC26A3NM_000111.2:c.1487T>G7107418647107418647AC214700Chloride diarrhea, congenital, Finnish typeHong Kong
SLC26A3NM_000111.2:c.1408-1G>A7107418727107418727CT214700Chloride diarrhea, congenital, Finnish typeGerman
SLC26A3NM_000111.2:c.1403A>T7107420117107420117TA214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1387C>T7107420133107420133GA214700Chloride diarrhea, congenital, Finnish typeFrench
SLC26A3NM_000111.2:c.1386G>A7107420134107420134CT214700Chloride diarrhea, congenital, Finnish typeBritish
SLC26A3NM_000111.2:c.1362delG7107420158107420158C-214700Chloride diarrhea, congenital, Finnish typeBelgian; Turkish
SLC26A3NM_000111.2:c.1360C>T7107420160107420160GA214700Chloride diarrhea, congenital, Finnish typeCanadian
SLC26A3NM_000111.2:c.1342_1343delTT7107420177107420178AA-214700Chloride diarrhea, congenital, Finnish typeJapanese
SLC26A3NM_000111.2:c.1312-1G>A7107420209107420209CT214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1306C>T7107423247107423247GA214700Chloride diarrhea, congenital, Finnish typeDutch
SLC26A3NM_000111.2:c.1193C>T7107423465107423465GA214700Chloride diarrhea, congenital, Finnish typeAustrian
SLC26A3NM_000111.2:c.1148_1149delTA7107423509107423510TA-214700Chloride diarrhea, congenital, Finnish typeAndalusian; Spanish
SLC26A3NM_000111.2:c.1136G>C7107423522107423522CG214700Chloride diarrhea, congenital, Finnish typeBritish
SLC26A3NM_000111.2:c.1030_1047delTTCGGCATCGCAATGGTTinsGATGCC7107423722107423739AACCATTGCGATGCCGAAGGCATC214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.1028G>A7107423741107423741CT214700Chloride diarrhea, congenital, Finnish typeFrench
SLC26A3NM_000111.2:c.736-?_971+?del7107427272107427954214700Chloride diarrhea, congenital, Finnish typeJapanese
SLC26A3NM_000111.2:c.272-?_971+?del7107427272107432385214700Chloride diarrhea, congenital, Finnish typeAustrian
SLC26A3NM_000111.2:c.951_953delGGT7107427290107427292ACC-214700Chloride diarrhea, congenital, Finnish typeFinnish
SLC26A3NM_000111.2:c.915C>A7107427328107427328GT214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.659A>C7107430045107430045TG214700Chloride diarrhea, congenital, Finnish typeAndalusian; Spanish
SLC26A3NM_000111.2:c.616T>C7107430088107430088AG214700Chloride diarrhea, congenital, Finnish typeDutch
SLC26A3NM_000111.2:c.610T>G7107430094107430094AC214700Chloride diarrhea, congenital, Finnish typeSpanish
SLC26A3NM_000111.2:c.571-1G>T7107430134107430134CA214700Chloride diarrhea, congenital, Finnish typeNorth American
SLC26A3NM_000111.2:c.571-2A>G7107430135107430135TC214700Chloride diarrhea, congenital, Finnish typeCanadian
SLC26A3NM_000111.2:c.559G>T7107431504107431504CA214700Chloride diarrhea, congenital, Finnish typeArab;Kuwaiti;Saudi Arab
SLC26A3NM_000111.2:c.525G>C7107431538107431538CG214700Chloride diarrhea, congenital, Finnish typeKorean
SLC26A3NM_000111.2:c.408G>A7107431655107431655CT214700Chloride diarrhea, congenital, Finnish typeEnglish
SLC26A3NM_000111.2:c.392delC7107431671107431671G-214700Chloride diarrhea, congenital, Finnish typeAustrian
SLC26A3NM_000111.2:c.392C>T7107431671107431671GA214700Chloride diarrhea, congenital, Finnish typeAmerican
SLC26A3NM_000111.2:c.392C>G7107431671107431671GC214700Chloride diarrhea, congenital, Finnish typeNorth American
SLC26A3NM_000111.2:c.386C>T7107431677107431677GA214700Chloride diarrhea, congenital, Finnish typeAustrian
SLC26A3NM_000111.2:c.371A>T7107432286107432286TA214700Chloride diarrhea, congenital, Finnish typePolish; French
SLC26A3NM_000111.2:c.358G>A7107432299107432299CT214700Chloride diarrhea, congenital, Finnish typePolish;Swedish; Norwegian
SLC26A3NM_000111.2:c.344delT7107432313107432313A-214700Chloride diarrhea, congenital, Finnish typePolish
SLC26A3NM_000111.2:c.332delT7107432325107432325A-214700Chloride diarrhea, congenital, Finnish typeSwedish
SLC26A3NM_000111.2:c.269_270dupAA7107434188107434189TTTTTT214700Chloride diarrhea, congenital, Finnish typeHong Kong
SLC26A3NM_000111.2:c.177dupC7107434281107434281GGG214700Chloride diarrhea, congenital, Finnish typeNorth American
SLC26A3NM_000111.2:c.145_157delAAGGCCAAGAGAA7107434301107434313TTCTCTTGGCCTT-214700Chloride diarrhea, congenital, Finnish typeBelgian
SLC26A3NM_000111.2:c.131+2_131+3ins288,GenebankU14569.17107434821107434822NNU14569.1214700Chloride diarrhea, congenital, Finnish typeQatar
SLC26A3NM_000111.2:c.-211-?_-89+?del7107443556107443678214700Chloride diarrhea, congenital, Finnish typeSwedish
CLN8NM_018941.3:c.(?_-305)_*144635289del817118701729899600143Ceroid lipofuscinosis, neuronal, 8Irish
CLN8NM_018941.3:c.46C>A817192661719266CA600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.66delG817192861719286G-600143Ceroid lipofuscinosis, neuronal, 8Italian
CLN8NM_018941.3:c.70C>G817192901719290CG610003Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variantFinnish
CLN8NM_018941.3:c.88delG817193081719308G-600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.88G>C817193081719308GC600143Ceroid lipofuscinosis, neuronal, 8Italian
CLN8NM_018941.3:c.180_182delGAA817194001719402GAA-600143Ceroid lipofuscinosis, neuronal, 8Italian
CLN8NM_018941.3:c.209G>A817194291719429GA600143Ceroid lipofuscinosis, neuronal, 8Indian;New Zealand
CLN8NM_018941.3:c.227A>G817194471719447AG600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.320T>G817195401719540TG600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.374A>G817195941719594AG600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.415C>T817196351719635CT600143Ceroid lipofuscinosis, neuronal, 8New Zealand
CLN8NM_018941.3:c.464C>T817196841719684CT600143Ceroid lipofuscinosis, neuronal, 8Finnish
CLN8NM_018941.3:c.470A>G817196901719690AG600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.473A>G817196931719693AG600143Ceroid lipofuscinosis, neuronal, 8Pakistani; Canadian
CLN8NM_018941.3:c.507C>T817197271719727CT600143Ceroid lipofuscinosis, neuronal, 8Finnish
CLN8NM_018941.3:c.509C>T817197291719729CT600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.509C>T817197291719729CT600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.544-2566_590del2613817258501728462600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.562_563delCT817284341728435CT-600143Ceroid lipofuscinosis, neuronal, 8Irish
CLN8NM_018941.3:c.581A>G817284531728453AG600143Ceroid lipofuscinosis, neuronal, 8Italian
CLN8NM_018941.3:c.610C>T817284821728482CT600143Ceroid lipofuscinosis, neuronal, 8Turkish; English
CLN8NM_018941.3:c.611G>T817284831728483GT600143Ceroid lipofuscinosis, neuronal, 8German
CLN8NM_018941.3:c.637_639delTGG817285091728511TGG-600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.661G>A817285331728533GA600143Ceroid lipofuscinosis, neuronal, 8Turkish
CLN8NM_018941.3:c.685C>G817285571728557CG600143Ceroid lipofuscinosis, neuronal, 8Mexican; Argentine
CLN8NM_018941.3:c.709G>A817285811728581GA610003;600143Ceroid lipofuscinosis, neuronal, 8;Ceroid lipofuscinosis, neuronal, 8, Northern epilepsy variantFinnish
CLN8NM_018941.3:c.766C>G817286381728638CG600143Ceroid lipofuscinosis, neuronal, 8Israeli
CLN8NM_018941.3:c.789G>C817286611728661GC600143Ceroid lipofuscinosis, neuronal, 8Turkish; Arab
CLN8NM_018941.3:c.806A>T817286781728678AT600143Ceroid lipofuscinosis, neuronal, 8Turkish
TMEM67NM_153704.5:c.161A>G89476730394767303AG607361Meckel syndrome 3European
TMEM67NM_153704.5:c.224-2delA89476800494768004A-607361Meckel syndrome 3German-Polish
TMEM67NM_153704.5:c.383_384delAC89477078194770782AC-607361Meckel syndrome 3Omani
TMEM67NM_153704.5:c.387T>A89477078594770785TA607361Meckel syndrome 3Italian
TMEM67NM_153704.5:c.579delA89477780294777802A-607361Meckel syndrome 3European
TMEM67NM_153704.5:c.579_580delAG89477780294777803AG-607361Meckel syndrome 3Moroccan
TMEM67NM_153704.5:c.622A>T89477784594777845AT607361Meckel syndrome 3European
TMEM67NM_153704.5:c.648delA89477787194777871A-607361Meckel syndrome 3Pakistani
TMEM67NM_153704.5:c.651+2G>T89477787694777876GT607361Meckel syndrome 3French
TMEM67NM_153704.5:c.675G>A89478484094784840GA607361Meckel syndrome 3Italian
TMEM67NM_153704.5:c.734C>T89479284094792840CT607361Meckel syndrome 3European
TMEM67NM_153704.5:c.755T>C89479286194792861TC607361Meckel syndrome 3European
TMEM67NM_153704.5:c.870-2A>G89479310094793100AG607361Meckel syndrome 3Pakistani
TMEM67NM_153704.5:c.870-2A>G89479310094793100AG607361Meckel syndrome 3Pakistani
TMEM67NM_153704.5:c.888G>T89479312094793120GT607361Meckel syndrome 3European
TMEM67NM_153704.5:c.1046T>C89479395394793953TC607361Meckel syndrome 3French; Algerian
TMEM67NM_153704.5:c.1065+1delG89479397394793973G-607361Meckel syndrome 3Palestinian
TMEM67NM_153704.5:c.1127A>C89479468494794684AC607361Meckel syndrome 3Pakistani
TMEM67NM_153704.5:c.1319G>A89479848194798481GA607361Meckel syndrome 3European
TMEM67NM_153704.5:c.1322G>T89479848494798484GT607361Meckel syndrome 3French
TMEM67NM_153704.5:c.1336G>C89479849894798498GC607361Meckel syndrome 3Moroccan
TMEM67NM_153704.5:c.1351C>T89479851394798513CT607361Meckel syndrome 3European
TMEM67NM_153704.5:c.1413-1G>C89480007194800071GC607361Meckel syndrome 3French
TMEM67NM_153704.5:c.1538A>G89480351094803510AG607361Meckel syndrome 3European
TMEM67NM_153704.5:c.1538_1539delAT89480351094803511AT-607361Meckel syndrome 3Senegal
TMEM67NM_153704.5:c.1575+1G>A89480354894803548GA607361Meckel syndrome 3Pakistani
TMEM67NM_153704.5:c.1575+1G>A89480354894803548GA607361Meckel syndrome 3Pakistani
TMEM67NM_153704.5:c.1675-?_2241+?del89480763794811986607361Meckel syndrome 3Ivory Coast
TMEM67NM_153704.5:c.1843T>C89480819894808198TC607361Meckel syndrome 3European
TMEM67NM_153704.5:c.2002T>C89480960094809600TC607361Meckel syndrome 3French
TMEM67NM_153704.5:c.2301delT89481589194815891T-607361Meckel syndrome 3French
TMEM67NM_153704.5:c.2322+2dupT89481591494815914TTT607361Meckel syndrome 3American
TMEM67NM_153704.5:c.2357G>A89481702494817024GA607361Meckel syndrome 3French
TMEM67NM_153704.5:c.2439G>A89481710694817106GA607361Meckel syndrome 3Moroccan
TMEM67NM_153704.5:c.2528A>G89482115694821156AG607361Meckel syndrome 3Italian
TMEM67NM_153704.5:c.2542G>T89482117094821170GT607361Meckel syndrome 3French
TMEM67NM_153704.5:c.2557A>T89482128594821285AT607361Meckel syndrome 3French
TMEM67NM_153704.5:c.2561dupA89482128994821289AAA607361Meckel syndrome 3American
TMEM67NM_153704.5:c.2689_2690insTA89482204094822041AAATAA607361Meckel syndrome 3French
TMEM67NM_153704.5:c.2897T>C89482766594827665TC607361Meckel syndrome 3European
VPS13BNM_017890.4:c.-79752_2516-7756del899945853100278670216550Cohen syndromeGerman/African
VPS13BNM_017890.4:c.-23990_1207-5855del8100001615100141005216550Cohen syndromeBelgian
VPS13BNM_017890.4:c.(?-12444)_996+?del8100013161100133463216550Cohen syndrome
VPS13BNM_017890.4:c.22_23delCCinsA8100026038100026039CCA216550Cohen syndromeDanish
VPS13BNM_017890.4:c.219_220delACinsT8100050722100050723ACT216550Cohen syndrome
VPS13BNM_017890.4:c.291+6437_2334-3424del8100057231100201680216550Cohen syndrome
VPS13BNM_017890.4:c.292-2A>G8100108538100108538AG216550Cohen syndrome
VPS13BNM_017890.4:c.292-?_1843+?dup8100108540100155393216550Cohen syndrome
VPS13BNM_017890.4:c.292-?_2333+?del8100108540100182391216550Cohen syndrome
VPS13BNM_017890.4:c.404dupT8100108652100108652TTT216550Cohen syndrome
VPS13BNM_017890.4:c.413-?_2013+?del8100115181100160238216550Cohen syndromeIranian
VPS13BNM_017890.4:c.467_470delATAA8100115235100115238ATAA-216550Cohen syndromeBritish
VPS13BNM_017890.4:c.581-?_2333+?del8100123326100182391216550Cohen syndromeGreek; Italian
VPS13BNM_017890.4:c.626_627delCA8100123371100123372CA-216550Cohen syndromeEuropean
VPS13BNM_017890.4:c.916_917delGA8100128081100128082GA-216550Cohen syndromeBelgian
VPS13BNM_017890.4:c.1207-2_2824+52509del8100146858100339991216550Cohen syndromeGerman
VPS13BNM_017890.4:c.1219C>T8100146872100146872CT216550Cohen syndromeSaudi Arab
VPS13BNM_017890.4:c.1225G>T8100146878100146878GT216550Cohen syndromePalestinian
VPS13BNM_017890.4:c.1269_1273delATTGT8100146922100146926ATTGT-216550Cohen syndromeEuropean
VPS13BNM_017890.4:c.1504C>T8100147902100147902CT216550Cohen syndromeBrazilian; European
VPS13BNM_017890.4:c.1563G>A8100147961100147961GA216550Cohen syndromeEuropean
VPS13BNM_017890.4:c.1768G>A8100155318100155318GA216550Cohen syndromeItalian
VPS13BNM_017890.4:c.1844-2A>G8100160067100160067AG216550Cohen syndrome
VPS13BNM_017890.4:c.2209-?_2333+?del8100168777100168971216550Cohen syndromeItalian
VPS13BNM_017890.4:c.2047delC8100168810100168810C-216550Cohen syndromeItalian
VPS13BNM_017890.4(/NM_017890.3):c.2074C>T8100168837100168837CT216550Cohen syndromeBelgian; French
VPS13BNM_017890.4:c.2334-8502_3082+9882del8100196602100413814216550Cohen syndrome
VPS13BNM_017890.4:c.2516-9218_2824+20330del8100277208100307812216550Cohen syndrome
VPS13BNM_017890.4:c.2516-?_3082+?del8100286426100403932216550Cohen syndromeGerman
VPS13BNM_017890.4:c.2516-?_4299+?del8100286426100520139216550Cohen syndromePolish
VPS13BNM_017890.4:c.2651-1G>A8100287308100287308GA216550Cohen syndromeIranian
VPS13BNM_017890.4:c.2727_2730dupGCTC8100287385100287388GCTCGCTCGCTC216550Cohen syndromePolish
VPS13BNM_017890.4:c.2824+51811_3082+4080del8100339293100408012216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.2825-?_4820+?dup8100396436100533238216550Cohen syndrome
VPS13BNM_017890.4:c.2889G>A8100396500100396500GA216550Cohen syndromeBritish
VPS13BNM_017890.4:c.2911C>T8100396522100396522CT216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.2934+1_2934+2delGT8100396546100396547GT-216550Cohen syndromeGerman
VPS13BNM_017890.4:c.3348_3349delCT8100454766100454767CT-216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.3427C>T8100454845100454845CT216550Cohen syndromeItalian
VPS13BNM_017890.4:c.3618T>A8100479814100479814TA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.3666+2T>C8100479864100479864TC216550Cohen syndrome
VPS13BNM_017890.4:c.3866C>G8100494026100494026CG216550Cohen syndromeGerman/African
VPS13BNM_017890.4:c.3870+9884_5024+1867del8100503914100570748216550Cohen syndromeArab
VPS13BNM_017890.4tässäsekveiolee30:c.4157-?_4158+?del8100515178100519998216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.4334delA8100523366100523366A-216550Cohen syndromeBritish
VPS13BNM_017890.4:c.4396dupA8100523428100523428AAA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.4411C>T8100523443100523443CT216550Cohen syndromeDutch
VPS13BNM_017890.4:c.4471G>T8100523503100523503GT216550Cohen syndromeBritish
VPS13BNM_017890.4:c.4474delA8100523506100523506A-216550Cohen syndrome
VPS13BNM_017890.4:c.4480_4482delCTT8100523512100523514CTT-216550Cohen syndromeIranian
VPS13BNM_017890.4:c.4572dupA8100523604100523604AAA216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.4820+2T>C8100533240100533240TC216550Cohen syndromeEuropean
VPS13BNM_017890.4:c.4878_4880dupATA8100568735100568737ATAATAATA216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.4923G>A8100568780100568780GA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.4955C>G8100568812100568812CG216550Cohen syndromeGerman
VPS13BNM_017890.4:c.5025-?_6121+?del8100587886100673719216550Cohen syndrome
VPS13BNM_017890.4:c.5069T>A8100587930100587930TA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.5086C>T8100587947100587947CT216550Cohen syndromeArab
VPS13BNM_017890.4:c.5086C>T8100587947100587947CT216550Cohen syndromeArab
VPS13BNM_017890.4:c.5152_5295del8100589718100589861216550Cohen syndromePolish
VPS13BNM_017890.4:c.5215_5232del8100589781100589798216550Cohen syndromeGerman
VPS13BNM_017890.4:c.5331dupT8100654074100654074TTT216550Cohen syndrome
VPS13BNM_017890.4:c.5426_5427dupAG8100654169100654170AGAGAG216550Cohen syndromeBelgian; French
VPS13BNM_017890.4:c.5461dupC8100654204100654204CCC216550Cohen syndromeFrench
VPS13BNM_017890.4:c.5613_5614insT8100654356100654357CACTA216550Cohen syndromeBritish
VPS13BNM_017890.4:c.5737dupA8100654480100654480AAA216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.5750delC8100654493100654493C-216550Cohen syndromeBritish
VPS13BNM_017890.4:c.5809_5810delAT8100654552100654553AT-216550Cohen syndromeJapanese
VPS13BNM_017890.4:c.5827C>T8100654570100654570CT216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.5920C>T8100654663100654663CT216550Cohen syndromePolish
VPS13BNM_017890.4:c.6420_6421delGA8100712051100712052GA-216550Cohen syndromeDanish
VPS13BNM_017890.4:c.6530_6732del8100729399100729601216550Cohen syndromeSyrian
VPS13BNM_017890.4:c.6578T>G8100729447100729447TG216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.6687delA8100729556100729556A-216550Cohen syndromeGerman
VPS13BNM_017890.4:c.6732+1G>A8100729602100729602GA216550Cohen syndromeIsraeli; European
VPS13BNM_017890.4:c.6733-2G>A8100732571100732571GA216550Cohen syndromeNorth American Caucasian
VPS13BNM_017890.4:c.6733-2A>G8100732571100732571AG216550Cohen syndromeAmerican;North American Caucasian
VPS13BNM_017890.4:c.7022A>G8100733172100733172AG216550Cohen syndromeGerman
VPS13BNM_017890.4:c.7051C>T8100733201100733201CT216550Cohen syndromeBelgian; French
VPS13BNM_017890.4:c.7126-?_8016+?del8100779002100796704216550Cohen syndrome
VPS13BNM_017890.4:c.7153G>T8100779029100779029GT216550Cohen syndromeFrench
VPS13BNM_017890.4:c.7221delG8100779097100779097G-216550Cohen syndromeJapanese
VPS13BNM_017890.4:c.7234_8016+8505del8100779110100805209216550Cohen syndrome
VPS13BNM_017890.4:c.7322_7322+1delGGinsATGGAGC8100779198100779199GGATGGAGC216550Cohen syndromeFrench
VPS13BNM_017890.4:c.7504+1G>A8100789185100789185GA216550Cohen syndromeItalian
VPS13BNM_017890.4:c.7603C>T8100791008100791008CT216550Cohen syndromeGerman; Italian
VPS13BNM_017890.4:c.7610G>A8100791015100791015GA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.7934G>A8100796622100796622GA216550Cohen syndromeOmani
VPS13BNM_017890.4:c.7934G>A8100796622100796622GA216550Cohen syndromeOmani
VPS13BNM_017890.4:c.7936delC8100796624100796624C-216550Cohen syndromePolish
VPS13BNM_017890.4:c.8017_8172del8100821603100821758216550Cohen syndromeBritish
VPS13BNM_017890.4:c.8119C>T8100821705100821705CT216550Cohen syndromeItalian
VPS13BNM_017890.4:c.8292C>A8100829887100829887CA216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.8318C>T8100829913100829913CT216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.8341delC8100829936100829936C-216550Cohen syndromeDanish
VPS13BNM_017890.4:c.8437-?_9258+?del8100830679100833710216550Cohen syndromeItalian
VPS13BNM_017890.4:c.8459T>C8100830701100830701TC216550Cohen syndromeAmish
VPS13BNM_017890.4:c.8472G>A8100830714100830714GA216550Cohen syndromeEnglish
VPS13BNM_017890.4:c.8515C>T8100830757100830757CT216550Cohen syndromeFrench
VPS13BNM_017890.4:c.8611delA8100831031100831031A-216550Cohen syndromeGerman
VPS13BNM_017890.4:c.8697-9A>G8100831631100831631AG216550Cohen syndromeItalian
VPS13BNM_017890.4:c.8697-2A>G8100831638100831638AG216550Cohen syndromeDutch
VPS13BNM_017890.4:c.8978A>G8100832259100832259AG216550Cohen syndromeBelgian
VPS13BNM_017890.4:c.9258_9259+1insT8100833710100833711GGGTG216550Cohen syndromeAmish
VPS13BNM_017890.4:c.9260dupT8100836061100836061TTT216550Cohen syndromeAmish
VPS13BNM_017890.4:c.9406-1G>T8100844596100844596GT216550Cohen syndromeLebanese
VPS13BNM_017890.4:c.9690-2A>G8100847423100847423AG216550Cohen syndromeBritish
VPS13BNM_017890.4:c.9706delT8100847441100847441T-216550Cohen syndromeBelgian
VPS13BNM_017890.4:c.9731delA8100847466100847466A-216550Cohen syndromeGerman
VPS13BNM_017890.4:c.10018_10136del8100861004100861122216550Cohen syndromeBritish
VPS13BNM_017890.4:c.10076_10077delCA8100861062100861063CA-216550Cohen syndromeItalian
VPS13BNM_017890.4:c.10156dupA8100865698100865698AAA216550Cohen syndromeItalian
VPS13BNM_017890.4:c.10456_10457delAG8100865998100865999AG-216550Cohen syndromeBelgian
VPS13BNM_017890.4:c.10841_10844delTCTC8100866383100866386TCTC-216550Cohen syndromeFinnish
VPS13BNM_017890.4:c.10888C>T8100866430100866430CT216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.[11713_11714ins10942+56_(11570+?_11571),10880_10899delCTGCGAGGCAGCTTGTGCACinsTT]8100866441100883676216550Cohen syndrome
VPS13BNM_017890.4:c.10946G>A8100871535100871535GA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.11125delC8100874009100874009C-216550Cohen syndromeItalian
VPS13BNM_017890.4:c.11169_11172dupGGAC8100874053100874056GGACGGACGGAC216550Cohen syndromeBritish
VPS13BNM_017890.4:c.11216G>A8100874100100874100GA216550Cohen syndromeGerman
VPS13BNM_017890.4:c.11245G>T8100874129100874129GT216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.11314C>T8100880540100880540CT216550Cohen syndromeGerman; Italian
VPS13BNM_017890.4:c.11505delA8100883050100883050A-216550Cohen syndromeGerman
VPS13BNM_017890.4:c.11556dupT8100883101100883101TTT216550Cohen syndrome
VPS13BNM_017890.4:c.11564delA8100883109100883109A-216550Cohen syndromeItalian
VPS13BNM_017890.4:c.11564_11565delAT8100883109100883110AT-216550Cohen syndromeTurkish
VPS13BNM_017890.4:c.11598delA8100883703100883703A-216550Cohen syndromeFrench
VPS13BNM_017890.4:c.11695_11698delAGTG8100883800100883803AGTG-216550Cohen syndrome
VPS13BNM_017890.4:c.11780_11784delCAGTGinsAA8100883885100883889CAGTGAA216550Cohen syndromeEuropean
VPS13BNM_017890.4:c.11825_11827dupATG8100887650100887652ATGATGATG216550Cohen syndromeGerman/African
VPS13BNM_017890.4:c.11906_11915delCCAGCTGTTC8100887731100887740CCAGCTGTTC-216550Cohen syndromeIsraeli
VPS13BNM_017890.4:c.11907dupC8100887732100887732CCC216550Cohen syndromeBritish; French
RECQL4NM_004260.3:c.3599_3600delCG8145736842145736843CG-266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.3271C>T8145737417145737417GA266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.3214A>T8145737550145737550TA266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.3072delA8145737692145737692T-266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.2476C>T8145738510145738510GA266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.2269C>T8145738796145738796GA266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.2091T>G8145739064145739064AC266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.2059-1G>A8145739097145739097CT266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.1910T>C8145739460145739460AG266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.1887_1890delGGAG8145739480145739483CTCC-266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.1885_1888delCGGG8145739482145739485CCCG-266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.1573delT8145740367145740367A-266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.1397C>T8145740620145740620GA266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.1390+2delT8145740708145740708A-266280RAPADILINO syndromeFinnish
RECQL4NM_004260.3:c.806G>A8145741697145741697CT266280RAPADILINO syndromeFinnish
GLDCNM_000170.2:c.471-?_(*553_?)del965324646610356605899Glycine encephalopathyTurkish
GLDCNM_000170.2:c.(?_-193)_(*553_?)del965324646645307605899Glycine encephalopathy
GLDCNM_000170.2:c.2919+1G>A965347076534707CT605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2896A>G965347316534731TC605899Glycine encephalopathySpanish
GLDCNM_000170.2:c.2891dupA965347366534736TTT605899Glycine encephalopathy
GLDCNM_000170.2:c.2869T>C965347586534758AG605899Glycine encephalopathyFrench-Vietnamese
GLDCNM_000170.2:c.2846C>T965347816534781GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2839-1G>C965347896534789CG605899Glycine encephalopathy
GLDCNM_000170.2:c.2838+5G>A965360596536059CT605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2714T>G965361886536188AC605899Glycine encephalopathy
GLDCNM_000170.2:c.2665+1G>C965400506540050CG605899Glycine encephalopathy
GLDCNM_000170.2:c.335-?_2665+?del965400516620319605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.2656C>T965400606540060GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2639A>T965400776540077TA605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2607C>A965401096540109GT605899Glycine encephalopathyIsraeli Bedouin
GLDCNM_000170.2:c.2574T>G965401426540142AC605899Glycine encephalopathy
GLDCNM_000170.2:c.335-?_2569+?del965508036620319605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.2521G>C965508516550851CG605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2519T>A965508536550853AT605899Glycine encephalopathy
GLDCNM_000170.2:c.2489C>T965508836550883GA605899Glycine encephalopathyGerman
GLDCNM_000170.2:c.2422delA965534036553403T-605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2414G>A965534116553411CT605899Glycine encephalopathy
GLDCNM_000170.2:c.2405C>T965534206553420GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2368C>T965534576553457GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2324A>G965535016553501TC605899Glycine encephalopathyGerman
GLDCNM_000170.2:c.2316-1G>A965535106553510CT605899Glycine encephalopathyGerman
GLDCNM_000170.2:c.2311G>A965546736554673CT605899Glycine encephalopathy
GLDCNM_000170.2:c.2306C>T965546786554678GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2293C>T965546916554691GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2284G>A965547006554700CT605899Glycine encephalopathyHispanic
GLDCNM_000170.2:c.2281G>C965547036554703CG605899Glycine encephalopathyFinnish
GLDCNM_000170.2:c.2267_2269delTCT965547156554717605899Glycine encephalopathy
GLDCNM_000170.2:c.2258A>C965547266554726TG605899Glycine encephalopathy
GLDCNM_000170.2:c.2216G>A965547686554768CT605899Glycine encephalopathy
GLDCNM_000170.2:c.2213_2214delGT965547706554771AC-605899Glycine encephalopathy
GLDCNM_000170.2:c.2203-2A>G965547836554783TC605899Glycine encephalopathyHispanic
GLDCNM_000170.2:c.2196T>A965561596556159AT605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2186delC965561696556169G-605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2182G>C965561736556173CG605899Glycine encephalopathy
GLDCNM_000170.2:c.2153_2155delACTinsTCCTGGTTTA965562006556202AGTTAAACCAGGA605899Glycine encephalopathyMoroccan
GLDCNM_000170.2:c.2113G>A965562426556242CT605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.2105C>T965562506556250GA605899Glycine encephalopathy
GLDCNM_000170.2:c.2098C>G965562576556257GC605899Glycine encephalopathy
GLDCNM_000170.2:c.2080G>C965562756556275CG605899Glycine encephalopathy
GLDCNM_000170.2:c.(?_-193)_2052+?del965585596645307605899Glycine encephalopathy
GLDCNM_000170.2:c.1996C>T965586156558615GA605899Glycine encephalopathy
GLDCNM_000170.2:c.1952A>G965586596558659TC605899Glycine encephalopathySpanish
GLDCNM_000170.2:c.1931G>T965586806558680CA605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.1926+1G>A965653536565353CT605899Glycine encephalopathy
GLDCNM_000170.2:c.(?_-193)_1926+?del965653546645307605899Glycine encephalopathyPakistani
GLDCNM_000170.2:c.1483-?_1850+?del965871416589292605899Glycine encephalopathyoriental
GLDCNM_000170.2:c.335-?_1850+?del965871416620319605899Glycine encephalopathy
GLDCNM_000170.2:c.1832T>G965871596587159AC605899Glycine encephalopathy
GLDCNM_000170.2:c.1822_1832delTATGACCAGGT965871606587170ACCTGGTCATA-605899Glycine encephalopathy
GLDCNM_000170.2:c.1786C>T965872056587205GA605899Glycine encephalopathy
GLDCNM_000170.2:c.1705G>A965884036588403CT605899Glycine encephalopathy
GLDCNM_000170.2:c.1691G>T965884176588417CA605899Glycine encephalopathyFinnish
GLDCNM_000170.2:c.1654A>G965886296588629TC605899Glycine encephalopathy
GLDCNM_000170.2:c.1597A>T965886866588686TA605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.1595C>G965886886588688GC605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.1545G>C965892306589230CG605899Glycine encephalopathy
GLDCNM_000170.2:c.1444dupG965921816592181CCC605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.1402-1G>C965922246592224CG605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.1382G>A965928706592870CT605899Glycine encephalopathy
GLDCNM_000170.2:c.1319T>A965929336592933AT605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.1285_1286insCAAA965929666592967AGATTTGG605899Glycine encephalopathySwiss
GLDCNM_000170.2:c.1270C>T965929826592982GA605899Glycine encephalopathy
GLDCNM_000170.2:c.1156-?_1261+?del965950146595119605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.335-?_1261+?del965950146620319605899Glycine encephalopathyOriental
GLDCNM_000170.2:c.1229G>A965950466595046CT605899Glycine encephalopathyFirst Nations
GLDCNM_000170.2:c.1175delC965951006595100G-605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.1166C>T965951096595109GA605899Glycine encephalopathy
GLDCNM_000170.2:c.1059-644_1155+4020del965980896602849605899Glycine encephalopathy
GLDCNM_000170.2:c.636-?_1155+?del966021096606669605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.335-?_1155+?del966021096620319605899Glycine encephalopathyOriental
GLDCNM_000170.2:c.1117C>T966021476602147GA605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.1111C>G966021536602153GC605899Glycine encephalopathyTaiwanese
GLDCNM_000170.2:c.1054delA966045926604592T-605899Glycine encephalopathyMixed Northern European
GLDCNM_000170.2:c.1009C>T966046376604637GA605899Glycine encephalopathyGerman
GLDCNM_000170.2:c.1002dupT966046446604644AAA605899Glycine encephalopathyCroatian
GLDCNM_000170.2:c.985C>A966046616604661GT605899Glycine encephalopathyIndian
GLDCNM_000170.2:c.937G>C966047096604709CG605899Glycine encephalopathyPuerto Rican
GLDCNM_000170.2:c.887T>G966047596604759AC605899Glycine encephalopathyOriental
GLDCNM_000170.2:c.861+1G>T966051306605130CA605899Glycine encephalopathyMoroccan
GLDCNM_000170.2:c.847G>C966051456605145CG605899Glycine encephalopathyNewfoundland
GLDCNM_000170.2:c.808G>T966051846605184CA605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.806C>T966051866605186GA605899Glycine encephalopathyOriental
GLDCNM_000170.2:c.793delC966051996605199G-605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.706C>T966065996606599GA605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.635G>A966101926610192CT605899Glycine encephalopathyFrench
GLDCNM_000170.2:c.335-?_635+?del966101926620319605899Glycine encephalopathyOriental
GLDCNM_000170.2:c.605C>T966102226610222GA605899Glycine encephalopathyCaucasian
GLDCNM_000170.2:c.560C>A966102676610267GT605899Glycine encephalopathyTurkish
GLDCNM_000170.2:c.513G>C966103146610314CG605899Glycine encephalopathySwiss
GLDCNM_000170.2:c.482A>G966103456610345TC605899Glycine encephalopathyPalestinian Arab
GLDCNM_000170.2:c.(?_-193)_470+?del966201846645307605899Glycine encephalopathyOriental
GLDCNM_000170.2:c.457G>T966201976620197CA605899Glycine encephalopathy
GLDCNM_000170.2:c.449A>C966202056620205TG605899Glycine encephalopathyJapanese
GLDCNM_000170.2:c.413A>T966202416620241TA605899Glycine encephalopathy
GLDCNM_000170.2:c.395C>G966202596620259GC605899Glycine encephalopathy
GLDCNM_000170.2:c.(?_-193)_334+?del966446146645307605899Glycine encephalopathy
GLDCNM_000170.2:c.254+1G>A966452456645245CT605899Glycine encephalopathy
GLDCNM_000170.2:c.(?_-193)_255+?del966452456645307605899Glycine encephalopathy
GLDCNM_000170.2:c.245T>G966452556645255AC605899Glycine encephalopathyJapanese
GLDCNM_000170.2:c.176G>C966453246645324CG605899Glycine encephalopathy
GLDCNM_000170.2:c.28delC966454726645472G-605899Glycine encephalopathy
GLDCNM_000170.2:c.2T>C966454986645498AG605899Glycine encephalopathyArab
RMRPNR_003051.3:n.*6T>C93565774235657742AG250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.257_266delCAGCGCGGCT93565775035657759AGCCGCGCTG-250250Cartilage-hair hypoplasiaSpanish-Mexican; American
RMRPNR_003051.3:n.265C>A93565775135657751GT250250Cartilage-hair hypoplasiaAustrian
RMRPNR_003051.3:n.263G>T93565775335657753CA250250Cartilage-hair hypoplasiaFinnish
RMRPNR_003051.3:n.263G>C93565775335657753CG250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.262C>T93565775435657754GA250250Cartilage-hair hypoplasiaIsraeli; Trinidadian
RMRPNR_003051.3:n.261C>G93565775535657755GC250250Cartilage-hair hypoplasiaItalian
RMRPNR_003051.3:n.249C>T93565776735657767GA250250Cartilage-hair hypoplasiaCanadian
RMRPNR_003051.3:n.245G>A93565777135657771CT250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.244C>T93565777235657772GA250250Cartilage-hair hypoplasiaCanadian
RMRPNR_003051.3:n.243A>G93565777335657773TC250250Cartilage-hair hypoplasiaBrazilian; Canadian
RMRPNR_003051.3:n.241A>C93565777535657775TG250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.239C>T93565777735657777GA250250Cartilage-hair hypoplasiaAustrian;American;Australian; Israeli
RMRPNR_003051.3:n.237A>G93565777935657779TC250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.231C>T93565778535657785GA250250Cartilage-hair hypoplasiaPolish
RMRPNR_003051.3:n.221T>C93565779535657795AG250250Cartilage-hair hypoplasiaItalian; German
RMRPNR_003051.3:n.219A>G93565779735657797TC250250Cartilage-hair hypoplasiaJapanese
RMRPNR_003051.3:n.218C>T93565779835657798GA250250Cartilage-hair hypoplasiaJapanese
RMRPNR_003051.3:n.215A>T93565780135657801TA250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.214C>G93565780235657802GC250250Cartilage-hair hypoplasiaGerman; German
RMRPNR_003051.3:n.212C>G93565780435657804GC250250Cartilage-hair hypoplasiaFinnish;American;Polish; German
RMRPNR_003051.3:n.196C>T93565782035657820GA250250Cartilage-hair hypoplasiaAmerican;Italian;Israeli;Brazilian;Swiss;European; Spanish-Mexican
RMRPNR_003051.3:n.195dupT93565782135657821AAA250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.194G>A93565782235657822CT250250Cartilage-hair hypoplasiaCanadian;German; English
RMRPNR_003051.3:n.183G>T93565783335657833CA250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.183G>C93565783335657833CG250250Cartilage-hair hypoplasiaDutch;English; Japanese
RMRPNR_003051.3:n.183G>A93565783335657833CT250250Cartilage-hair hypoplasiaJapanese
RMRPNR_003051.3:n.181G>A93565783535657835CT250250Cartilage-hair hypoplasiaMexican;German; American
RMRPNR_003051.3:n.180_181insC93565783535657836CGCGG250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.169G>A93565784735657847CT250250Cartilage-hair hypoplasiaJapanese
RMRPNR_003051.3:n.155G>T93565786135657861CA250250Cartilage-hair hypoplasiaFinnish
RMRPNR_003051.3:n.155G>C93565786135657861CG250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.153A>G93565786335657863TC250250Cartilage-hair hypoplasiaCanadian
RMRPNR_003051.3:n.147G>C93565786935657869CG250250Cartilage-hair hypoplasiaItalian
RMRPNR_003051.3:n.147G>A93565786935657869CT250250Cartilage-hair hypoplasiaChinese; French
RMRPNR_003051.3:n.128G>C93565788835657888CG250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.128G>A93565788835657888CT250250Cartilage-hair hypoplasiaItalian; Canadian
RMRPNR_003051.3:n.127C>T93565788935657889GA250250Cartilage-hair hypoplasiaArab;Italian; Turkish
RMRPNR_003051.3:n.125C>T93565789135657891GA250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.119A>G93565789735657897TC250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.117A>G93565789935657899TC250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.92G>A93565791435657914GA250250Cartilage-hair hypoplasiaBelgian
RMRPNR_003051.3:n.98G>A93565791835657918CT250250Cartilage-hair hypoplasiaGerman; American
RMRPNR_003051.3:n.97_98dupTG93565791835657919CACACA250250Cartilage-hair hypoplasiaCanadian;Swiss; Turkish
RMRPNR_003051.3:n.95_96delAG93565792035657921CT-250250Cartilage-hair hypoplasiaEnglish
RMRPNR_003051.3:n.94G>C93565792235657922CG250250Cartilage-hair hypoplasiaDutch
RMRPNR_003051.3:n.93dupA93565792335657923TTT250250Cartilage-hair hypoplasiaTurkish
RMRPNR_003051.3:n.102C>T93565792435657924CT250250Cartilage-hair hypoplasiaBelgian
RMRPNR_003051.3:n.90C>G93565792635657926GC250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.81G>A93565793535657935CT250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.80G>A93565793635657936CT250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.78C>T93565793835657938GA250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.77C>T93565793935657939GA250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.71A>G93565794535657945TC250250Cartilage-hair hypoplasiaFinnish;American;Australian;Austrian;Belgian;Brazilian;Canadian;Dutch;English;French;German;Turkish;Irish; Mexican
RMRPNR_003051.3:n.69_70delGGinsTT93565794635657947CCAA250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.65T>C93565795135657951AG250250Cartilage-hair hypoplasiaItalian
RMRPNR_003051.3:n.64C>T93565795235657952GA250250Cartilage-hair hypoplasiaDutch;Australian;French; Caucasian-African-American
RMRPNR_003051.3:n.62G>A93565795435657954CT250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.57_58insTTCCGCCT93565795835657959AAAAGGCGGAAA250250Cartilage-hair hypoplasiaFrench
RMRPNR_003051.3:n.46_54dupTGTTCCTCC93565796235657970GGAGGAACAGGAGGAACAGGAGGAACA250250Cartilage-hair hypoplasiaDutch
RMRPNR_003051.3:n.41G>A93565797535657975CT250250Cartilage-hair hypoplasiaDutch
RMRPNR_003051.3:n.36C>T93565798035657980GA250250Cartilage-hair hypoplasiaFrench
RMRPNR_003051.3:n.28G>A93565798835657988CT250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.19G>C93565799735657997CG250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.15G>T93565800135658001CA250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.12A>G93565800435658004TC250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.10T>C93565800635658006AG250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.5C>T93565801135658011GA250250Cartilage-hair hypoplasiaAustralian;Dutch;English;German;Spanish;Swiss; Italian
RMRPNR_003051.3:n.-6_4dupGGACGTGGTT93565801235658021AACCACGTCCAACCACGTCCAACCACGTCC250250Cartilage-hair hypoplasiaBrazilian
RMRPNR_003051.3:n.-14_3dupGAAGCTGAGGACGTGGT93565801335658029ACCACGTCCTCAGCTTCACCACGTCCTCAGCTTCACCACGTCCTCAGCTTC250250Cartilage-hair hypoplasiaJapanese
RMRPNR_003051.3:n.-3_1dupCGTG93565801535658018CACGCACGCACG250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-7_1dupAGGACGTG93565801535658022CACGTCCTCACGTCCTCACGTCCT250250Cartilage-hair hypoplasiaCanadian
RMRPNR_003051.3:n.-13_1dupAAGCTGAGGACGTG93565801535658028CACGTCCTCAGCTTCACGTCCTCAGCTTCACGTCCTCAGCTT250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.-15_1dupTGAAGCTGAGGACGTG93565801535658030CACGTCCTCAGCTTCACACGTCCTCAGCTTCACACGTCCTCAGCTTCA250250Cartilage-hair hypoplasiaJapanese
RMRPNR_003051.3:n.-20_1dupCTCTGTGAAGCTGAGGACGTG93565801535658035CACGTCCTCAGCTTCACAGAGCACGTCCTCAGCTTCACAGAGCACGTCCTCAGCTTCACAGAG250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.-8_-1dupGAGGACGT93565801635658023ACGTCCTCACGTCCTCACGTCCTC250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-13_-2dupAAGCTGAGGACG93565801735658028CGTCCTCAGCTTCGTCCTCAGCTTCGTCCTCAGCTT250250Cartilage-hair hypoplasiaSwiss; European
RMRPNR_003051.3:n.-4_-3insGGACGTGGTT93565801835658019NNNAACCACGTCCN250250Cartilage-hair hypoplasiaFrench
RMRPNR_003051.3:n.-19_-3dupTCTGTGAAGCTGAGGAC93565801835658034GTCCTCAGCTTCACAGAGTCCTCAGCTTCACAGAGTCCTCAGCTTCACAGA250250Cartilage-hair hypoplasiaEnglish; Swiss
RMRPNR_003051.3:n.-22_-3dupTACTCTGTGAAGCTGAGGAC93565801835658037GTCCTCAGCTTCACAGAGTAGTCCTCAGCTTCACAGAGTAGTCCTCAGCTTCACAGAGTA250250Cartilage-hair hypoplasiaJapanese; German
RMRPNR_003051.3:n.-24_-4dupACTACTCTGTGAAGCTGAGGA93565801935658039TCCTCAGCTTCACAGAGTAGTTCCTCAGCTTCACAGAGTAGTTCCTCAGCTTCACAGAGTAGT250250Cartilage-hair hypoplasiaGerman; Belgian
RMRPNR_003051.3:n.-25_-4dupTACTACTCTGTGAAGCTGAGGA93565801935658040TCCTCAGCTTCACAGAGTAGTATCCTCAGCTTCACAGAGTAGTATCCTCAGCTTCACAGAGTAGTA250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.-10_-4delCTGAGGAins289356580193565802528TCCTCAG28bpinsert250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-6_-5insCCTGAG93565802035658021NNNCTCAGGN250250Cartilage-hair hypoplasiaGerman
RMRPNR_003051.3:n.-13_-6dupAAGCTGAG93565802135658028CTCAGCTTCTCAGCTTCTCAGCTT250250Cartilage-hair hypoplasiaMexican
RMRPNR_003051.3:n.-15_-6dupTGAAGCTGAG93565802135658030CTCAGCTTCACTCAGCTTCACTCAGCTTCA250250Cartilage-hair hypoplasiaFrench
RMRPNR_003051.3:n.-22-6dupTACTCTGTGAAGCTGAG93565802135658037CTCAGCTTCACAGAGTACTCAGCTTCACAGAGTACTCAGCTTCACAGAGTA250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-10_-9insTACTCTGTGAAGTACTCTGTGAAGCTGA93565802435658025NNNTCAGCTTCACAGAGTACTTCACAGAGTAN250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-21_-9dupACTCTGTGAAGCT93565802435658036AGCTTCACAGAGTAGCTTCACAGAGTAGCTTCACAGAGT250250Cartilage-hair hypoplasiaFrench
RMRPNR_003051.3:n.-24_-9ACTACTCTGTGAAGCT[3]93565802435658039AGCTTCACAGAGTAGTAGCTTCACAGAGTAGTAGCTTCACAGAGTAGTAGCTTCACAGAGTAGT250250Cartilage-hair hypoplasiaItalian
RMRPNR_003051.3:n.-24_-10dupACTACTCTGTGAAGC93565802535658039GCTTCACAGAGTAGTGCTTCACAGAGTAGTGCTTCACAGAGTAGT250250Cartilage-hair hypoplasiaGerman; Spanish
RMRPNR_003051.3:n.-24_-10ACTACTCTGTGAAGC[3]93565802535658039GCTTCACAGAGTAGTGCTTCACAGAGTAGTGCTTCACAGAGTAGTGCTTCACAGAGTAGT250250Cartilage-hair hypoplasiaSwiss
RMRPNR_003051.3:n.-13_-12insATCTGTG93565802735658028NNNCACAGATN250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-24_-12dupACTACTCTGTGAA93565802735658039TTCACAGAGTAGTTTCACAGAGTAGTTTCACAGAGTAGT250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-19_-13dupTCTGTGA93565802835658034TCACAGATCACAGATCACAGA250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.-20_-13CTCTGTGA[3]93565802835658035GCTTCACAGAGTAGTGCTTCACAGAGTAGTGCTTCACAGAGTAGTGCTTCACAGAGTAGT250250Cartilage-hair hypoplasia
RMRPNR_003051.3:n.-22_-13dupTACTCTGTGA93565802835658037TCACAGAGTATCACAGAGTATCACAGAGTA250250Cartilage-hair hypoplasiaFinnish; French
RMRPNR_003051.3:n.-22_-14dupTACTCTGTG93565802935658037CACAGAGTACACAGAGTACACAGAGTA250250Cartilage-hair hypoplasiaFrench
RMRPNR_003051.3:n.-23_-14dupCTACTCTGTG93565802935658038CACAGAGTAGCACAGAGTAGCACAGAGTAG250250Cartilage-hair hypoplasiaAmerican
RMRPNR_003051.3:n.-24_-18dupACTACTC93565803335658039GAGTAGTGAGTAGTGAGTAGT250250Cartilage-hair hypoplasiaThai
RMRPNR_003051.3:n.-20_-19insTCTGTGAAGCTGGGGAC93565803435658035NNNGTCCCCAGCTTCACAGAN250250Cartilage-hair hypoplasiaJapanese
GSNNM_000177.4:c.640G>A9124073097124073097GA105120Amyloidosis, Finnish typeFinnish;American;Dutch; Japanese
GSNNM_000177.4:c.640G>T9124073097124073097GT105120Amyloidosis, Finnish typeDanish;Czech;Brazilian; French
GLE1NM_001003722.1:c.433-10A>G9131284937131284937AG253310;611890Lethal congenital contracture syndrome 1;Arthrogryposis, lethal, with anterior horn cell diseaseFinnish
GLE1NM_001003722.1:c.1706G>A9131298693131298693GA611890Lethal congenital contracture syndrome 1Finnish
GLE1NM_001003722.1:c.1849G>A9131300337131300337GA611890Arthrogryposis, lethal, with anterior horn cell diseaseFinnish
GLE1NM_001003722.1:c.2051T>C9131303403131303403TC611890Arthrogryposis, lethal, with anterior horn cell diseaseFinnish
CUBNNM_001081.3:c.(?_-52)_(*1009_?)del101686596517171816261100Megaloblastic anemia-1, Finnish typeGerman; Spanish
CUBNNM_001081.3:c.4168G>A101706183217061832CT261100Megaloblastic anemia-1, Finnish typeEnglish
CUBNNM_001081.3:c.4115C>G101706188517061885GC261100Megaloblastic anemia-1, Finnish typeTurkish
CUBNNM_001081.3:c.(?_-52)_4018+?del101706198217171816261100Megaloblastic anemia-1, Finnish typePakistani
CUBNNM_001081.3:c.3999C>A101708305017083050GT261100Megaloblastic anemia-1, Finnish typeFinnish
CUBNNM_001081.3:c.3890C>T101708315917083159GA261100Megaloblastic anemia-1, Finnish typeFinnish
CUBNNM_001081.3:c.3890C>T101708315917083159GA261100Megaloblastic anemia-1, Finnish typeFinnish
CUBNNM_001081.3:c.3749C>T101708590617085906GA261100Megaloblastic anemia-1, Finnish typeTurkish
CUBNNM_001081.3:c.3577T>G101708710117087101AC261100Megaloblastic anemia-1, Finnish typeMoroccan
CUBNNM_001081.3:c.3330-439C>G101708853217088532GC261100Megaloblastic anemia-1, Finnish typeFinnish
CUBNNM_001081.3:c.3330-439C>G101708853217088532GC261100Megaloblastic anemia-1, Finnish typeSwedish
CUBNNM_001081.3:c.3096delT101710755017107550A-261100Megaloblastic anemia-1, Finnish typeNorthern European
CUBNNM_001081.3:c.3056C>G101710759017107590GC261100Megaloblastic anemia-1, Finnish typeAlgerian
CUBNNM_001081.3:c.2949C>A101711012217110122GT261100Megaloblastic anemia-1, Finnish typeSpanish
CUBNNM_001081.3:c.2673C>A101711072217110722GT261100Megaloblastic anemia-1, Finnish typeWestern European
CUBNNM_001081.3:c.2614_2615delGA101711343517113436TC-261100Megaloblastic anemia-1, Finnish typeAshkenazis
CUBNNM_001081.3:c.2594G>A101711345617113456CT261100Megaloblastic anemia-1, Finnish typeAlbanian;Scottish; Turkish
CUBNNM_001081.3:c.2515_2533delGAAAGAACCTGTAGGTGGA101711351717113535TCCACCTACAGGTTCTTTC-261100Megaloblastic anemia-1, Finnish typeEnglish
CUBNNM_001081.3:c.2486C>T101711356417113564GA261100Megaloblastic anemia-1, Finnish typeDutch
CUBNNM_001081.3:c.2068A>G101712763817127638TC261100Megaloblastic anemia-1, Finnish typeSwedish
CUBNNM_001081.3:c.1951C>T101712775517127755GA261100Megaloblastic anemia-1, Finnish typeTurkish
CUBNNM_001081.3:c.1951C>G101712775517127755GC261100Megaloblastic anemia-1, Finnish typeTaiwanese
CUBNNM_001081.3:c.1865delC101713024517130245G-261100Megaloblastic anemia-1, Finnish typeWestern European
CUBNNM_001081.3:c.1838delG101713027217130272C-261100Megaloblastic anemia-1, Finnish typeFinnish
CUBNNM_001081.3:c.1530G>A101714512417145124CT261100Megaloblastic anemia-1, Finnish typeGerman
CUBNNM_001081.3:c.1526delG101714512817145128C-261100Megaloblastic anemia-1, Finnish typeWestern European
CUBNNM_001081.3:c.1436C>G101714521817145218GC261100Megaloblastic anemia-1, Finnish typeSpanish
CUBNNM_001081.3:c.1230+1G>A101714745517147455CT261100Megaloblastic anemia-1, Finnish typeFinnish
CUBNNM_001081.3:c.1010C>T101715292317152923GA261100Megaloblastic anemia-1, Finnish typeGerman; European
CUBNNM_001081.3:c.889C>T101715304417153044GA261100Megaloblastic anemia-1, Finnish typeGerman
CUBNNM_001081.3:c.673T>A101715751717157517AT261100Megaloblastic anemia-1, Finnish typeNorwegian
CUBNNM_001081.3:c.489G>A101716558717165587CT261100Megaloblastic anemia-1, Finnish typeGerman
CUBNNM_001081.3:c.434G>A101716564217165642CT261100Megaloblastic anemia-1, Finnish typeBedouin
CUBNNM_001081.3:c.252+1G>A101717111917171119CT261100Megaloblastic anemia-1, Finnish typePakistani
CUBNNM_001081.3:c.250C>T101717112217171122GA261100Megaloblastic anemia-1, Finnish typeTurkish
C10orf2NM_021830.4:c.247C>T10102748214102748214CT271245Mitochondrial DNA depletion syndrome 7 (hepatocerebral type)English
C10orf2NM_021830.4:c.1287C>T10102749444102749444CT271245Mitochondrial DNA depletion syndrome 7 (hepatocerebral type)Finnish
C10orf2NM_021830.4:c.1366C>G10102749523102749523CG271245Mitochondrial DNA depletion syndrome 7 (hepatocerebral type)Turkish
C10orf2NM_021830.4:c.1387C>T10102749544102749544CT271245Mitochondrial DNA depletion syndrome 7 (hepatocerebral type)English
C10orf2NM_021830.4:c.1523A>G10102750231102750231AG271245Mitochondrial DNA depletion syndrome 7 (hepatocerebral type)Finnish
OATNM_000274.3:c.1311G>T10126086520126086520CA258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.1311G>T10126086520126086520CA258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.1307T>A10126086524126086524AT258870Gyrate atrophy of choroid and retina with or without ornithinemiaSouthern Italian
OATNM_000274.3:c.1276C>T10126086555126086555GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.1250C>T10126086581126086581GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.1250C>T10126086581126086581GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.1205T>C10126086626126086626AG258870Gyrate atrophy of choroid and retina with or without ornithinemiaFinnish
OATNM_000274.3:c.1201G>T10126086630126086630CA258870Gyrate atrophy of choroid and retina with or without ornithinemiaGerman/American
OATNM_000274.3:c.1192C>T10126086639126086639GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaAustralian
OATNM_000274.3:c.1186C>T10126086645126086645GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaEast Indian
OATNM_000274.3:c.1181G>A10126086650126086650CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaSouthern Italian
OATNM_000274.3:c.1180T>C10126086651126086651AG258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.1172G>A10126086659126086659CT258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.1124G>C10126089444126089444CG258870Gyrate atrophy of choroid and retina with or without ornithinemiaHispanic
OATNM_000274.3:c.1118G>A10126089450126089450CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish-German
OATNM_000274.3:c.1058G>A10126089510126089510CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaSpanish
OATNM_000274.3:c.1031delA10126089537126089537T-258870Gyrate atrophy of choroid and retina with or without ornithinemiaWest African
OATNM_000274.3:c.994G>A10126090315126090315CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaSouthern Italian
OATNM_000274.3:c.994G>A10126090315126090315CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaSouthern Italian
OATNM_000274.3:c.991C>T10126090318126090318GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaTurkish; Greek
OATNM_000274.3:c.978T>A10126090331126090331AT258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.955C>T10126090354126090354GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.952delG10126090357126090357C-258870Gyrate atrophy of choroid and retina with or without ornithinemiaTurkish
OATNM_000274.3:c.952G>A10126090357126090357CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.901-2A>G10126090410126090410TC258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.897C>G10126091499126091499GC258870Gyrate atrophy of choroid and retina with or without ornithinemiaEuropean
OATNM_000274.3:c.824G>A10126091572126091572CT258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.812G>A10126091584126091584CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.808G>C10126091588126091588CG258870Gyrate atrophy of choroid and retina with or without ornithinemiaPortugese
OATNM_000274.3:c.800C>T10126091596126091596GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaAshkenazis
OATNM_000274.3:c.749G>C10126092389126092389CG258870Gyrate atrophy of choroid and retina with or without ornithinemiaFrench
OATNM_000274.3:c.748C>T10126092390126092390GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.734A>G10126092404126092404TC258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.722C>T10126092416126092416GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaGerman/Italian
OATNM_000274.3:c.710G>A10126092428126092428CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.698A>G10126092440126092440TC258870Gyrate atrophy of choroid and retina with or without ornithinemiaMexican
OATNM_000274.3:c.677C>T10126092461126092461GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaAustralian
OATNM_000274.3:c.521-172_648+772del10126093233126094304258870Gyrate atrophy of choroid and retina with or without ornithinemiaEuropean
OATNM_000274.3:c.521-?_648+?del10126094005126094132258870Gyrate atrophy of choroid and retina with or without ornithinemiaEuropean
OATNM_000274.3:c.627T>A10126094026126094026AT258870Gyrate atrophy of choroid and retina with or without ornithinemiaEuropean
OATNM_000274.3:c.596C>A10126094057126094057GT258870Gyrate atrophy of choroid and retina with or without ornithinemiaCanadian; English
OATNM_000274.3:c.583G>T10126094070126094070CA258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.550_552delGCT10126094101126094103AGC-258870Gyrate atrophy of choroid and retina with or without ornithinemiaPortugese
OATNM_000274.3:c.550G>A10126094103126094103CT258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.542C>T10126094111126094111GA258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.539G>C10126094114126094114CG258870Gyrate atrophy of choroid and retina with or without ornithinemiaFinnish;American; European
OATNM_000274.3:c.532_536delTGGGG10126094117126094121CCCCA-258870Gyrate atrophy of choroid and retina with or without ornithinemiaGerman
OATNM_000274.3:c.533G>A10126094120126094120CT258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.472_486delTATACCGTGAAGGGC10126097145126097159GCCCTTCACGGTATA-258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.461G>T10126097170126097170CA258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish/German
OATNM_000274.3:c.425-5_428del10126097203126097211258870Gyrate atrophy of choroid and retina with or without ornithinemiaDanish/Swedish
OATNM_000274.3:c.425G>A10126097206126097206CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.425-2A>G10126097208126097208TC258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.381dupT10126097353126097353AAA258870Gyrate atrophy of choroid and retina with or without ornithinemiaWelsh
OATNM_000274.3:c.373_375delGAG10126097359126097361CTC-258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.362G>A10126097372126097372CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.311A>G10126097423126097423TC258870Gyrate atrophy of choroid and retina with or without ornithinemiaGreek
OATNM_000274.3:c.278G>T10126097456126097456CA258870Gyrate atrophy of choroid and retina with or without ornithinemiaGerman/Italian
OATNM_000274.3:c.272G>A10126097462126097462CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.268C>G10126097466126097466GC258870Gyrate atrophy of choroid and retina with or without ornithinemiaJapanese
OATNM_000274.3:c.267C>A10126097467126097467GT258870Gyrate atrophy of choroid and retina with or without ornithinemiaFinnish
OATNM_000274.3:c.199+303C>G10126100239126100239GC258870Gyrate atrophy of choroid and retina with or without ornithinemiaAlgerian
OATNM_000274.3:c.192_193delAG10126100548126100549CT-258870Gyrate atrophy of choroid and retina with or without ornithinemiaCanadian
OATNM_000274.3:c.163T>C10126100578126100578AG258870Gyrate atrophy of choroid and retina with or without ornithinemiaAust/Hung/English
OATNM_000274.3:c.163T>C10126100578126100578AG258870Gyrate atrophy of choroid and retina with or without ornithinemiaEnglish
OATNM_000274.3:c.162C>A10126100579126100579GT258870Gyrate atrophy of choroid and retina with or without ornithinemia
OATNM_000274.3:c.159delC10126100582126100582G-258870Gyrate atrophy of choroid and retina with or without ornithinemiaIraqi Jew
OATNM_000274.3:c.152G>A10126100589126100589CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaSouthern Italian;English
OATNM_000274.3:c.3G>A10126100738126100738CT258870Gyrate atrophy of choroid and retina with or without ornithinemiaLebanese Maronite
TMEM216NM_001173991.1:c.230G>C116116524661165246GC603194Meckel syndrome 2Palestinian
TMEM216NM_001173991.1:c.253C>T116116526961165269CT603194Meckel syndrome 2British
TMEM216NM_001173991.1:c.341T>G116116535761165357TG603194Meckel syndrome 2Tunisian
HYLS1NM_001134793.101724:c.632A>G11125769895125769895AG236680Hydrolethalus syndrome 1Finnish
CEP290NM_025114.3:c.5850delT128846556388465563A-611134Meckel syndrome 4European
CEP290NM_025114.3:c.5493delA128847156788471567T-611134Meckel syndrome 4Kosovo-Albanian;other European
CEP290NM_025114.3:c.4115_4116delTA128848163588481636TA-611134Meckel syndrome 4French
CEP290NM_025114.3:c.3446_3447delAA128848647288486473TT-611134Meckel syndrome 4Finnish
CEP290NM_025114.3:c.3175delA128848768188487681T-611134Meckel syndrome 4Tunisian
CEP290NM_025114.3:c.1984C>T128850826588508265GA611134Meckel syndrome 4European; French
CEP290NM_025114.3:c.1860_1861delAA128850892388508924TT-611134Meckel syndrome 4
CEP290NM_025114.3:c.1451delA128851396288513962T-611134Meckel syndrome 4British
CEP290NM_025114.3:c.1219_1220delAT128851491388514914AT-611134Meckel syndrome 4Finnish;French;other European
CEP290NM_025114.3:c.613C>T128852410188524101GA611134Meckel syndrome 4Moroccan
CEP290NM_025114.3:c.384_387delTAGA128853047488530477TCTA-611134Meckel syndrome 4Tunisian; French
CEP290NM_025114.3:c.381_382delAGinsT128853047988530480CTA611134Meckel syndrome 4
CEP290NM_025114.3:c.289G>T128853293088532930CA611134Meckel syndrome 4European
CEP290NM_025114.3:c.180+2T>A128853473188534731AT611134Meckel syndrome 4Tunisian; French
KERANM_007035.3:c.1026delC129144515691445156G-217300Cornea plana 2Arab
KERANM_007035.3:c.937C>T129144524591445245GA217300Cornea plana 2Arab
KERANM_007035.3:c.835C>T129144922491449224GA217300Cornea plana 2Saudi Arab
KERANM_007035.3:c.740A>G129144931991449319TC217300Cornea plana 2Finnish; British
KERANM_007035.3:c.644C>A129144941591449415GT217300Cornea plana 2Bangladeshi
KERANM_007035.3:c.520C>T129144953991449539GA217300Cornea plana 2American
KERANM_007035.3:c.391A>G129144966891449668TC217300Cornea plana 2Hispanic
CLN5NM_006493.2:c.4C>T137756609077566090CT256731Ceroid lipofuscinosis, neuronal, 5Argentine;Turkish;English;Canadian; Czech
CLN5NM_006493.2:c.61C>T137756614777566147CT256731Ceroid lipofuscinosis, neuronal, 5Turkish
CLN5NM_006493.2:c.72A>G137756615877566158AG256731Ceroid lipofuscinosis, neuronal, 5American; Argentine
CLN5NM_006493.2:c.223T>C137756630977566309TC256731Ceroid lipofuscinosis, neuronal, 5Turkish
CLN5NM_006493.2:c.225G>A137756631177566311GA256731Ceroid lipofuscinosis, neuronal, 5Finnish; Canadian
CLN5NM_006493.2:c.291dupC137756637777566377CCC256731Ceroid lipofuscinosis, neuronal, 5Argentine
CLN5NM_006493.2:c.291dupC137756637777566377CCC256731Ceroid lipofuscinosis, neuronal, 5Argentine
CLN5NM_006493.2:c.335G>C137756921277569212GC256731Ceroid lipofuscinosis, neuronal, 5Portugese
CLN5NM_006493.2:c.377G>A137756925477569254GA256731Ceroid lipofuscinosis, neuronal, 5American
CLN5NM_006493.2:c.433C>T137756931077569310CT256731Ceroid lipofuscinosis, neuronal, 5English
CLN5NM_006493.2:c.486+5G>C137756936877569368GC256731Ceroid lipofuscinosis, neuronal, 5Canadian
CLN5NM_006493.2:c.486+139_712+2132del137756950277572394256731Ceroid lipofuscinosis, neuronal, 5
CLN5NM_006493.2:c.524T>G137757007477570074TG256731Ceroid lipofuscinosis, neuronal, 5Turkish
CLN5NM_006493.2:c.527_528insA137757007777570078CTCAT256731Ceroid lipofuscinosis, neuronal, 5Pakistan/American
CLN5NM_006493.2:c.528T>G137757007877570078TG256731Ceroid lipofuscinosis, neuronal, 5Swedish; Argentine
CLN5NM_006493.2:c.565C>T137757011577570115CT256731Ceroid lipofuscinosis, neuronal, 5Portugese
CLN5NM_006493.2:c.575A>G137757012577570125AG256731Ceroid lipofuscinosis, neuronal, 5American
CLN5NM_006493.2:c.593T>C137757014377570143TC256731Ceroid lipofuscinosis, neuronal, 5Turkish
CLN5NM_006493.2:c.613C>T137757016377570163CT256731Ceroid lipofuscinosis, neuronal, 5Canadian; Qatar
CLN5NM_006493.2:c.619T>C137757016977570169TC256731Ceroid lipofuscinosis, neuronal, 5English
CLN5NM_006493.2:c.620G>C137757017077570170GC256731Ceroid lipofuscinosis, neuronal, 5Chinese/American
CLN5NM_006493.2:c.669dupC137757021977570219CCC256731Ceroid lipofuscinosis, neuronal, 5Finnish;Swedish; Canadian
CLN5NM_006493.2:c.671G>A137757022177570221GA256731Ceroid lipofuscinosis, neuronal, 5American; English
CLN5NM_006493.2:c.726C>A137757460677574606CA256731Ceroid lipofuscinosis, neuronal, 5English; Turkish
CLN5NM_006493.2:c.772T>G137757465277574652TG256731Ceroid lipofuscinosis, neuronal, 5Italian
CLN5NM_006493.2:c.835G>A137757471577574715GA256731Ceroid lipofuscinosis, neuronal, 5Portugese; Dutch
CLN5NM_006493.2:c.907_1094del188137757478777574974256731Ceroid lipofuscinosis, neuronal, 5American
CLN5NM_006493.2:c.919delA137757479977574799A-256731Ceroid lipofuscinosis, neuronal, 5Egyptian/American; Egyptian
CLN5NM_006493.2:c.955_970delGGAAATGAAACATCTG137757483577574850GGAAATGAAACATCTG-256731Ceroid lipofuscinosis, neuronal, 5English
CLN5NM_006493.2:c.1026C>A137757490677574906CA256731Ceroid lipofuscinosis, neuronal, 5Czech
CLN5NM_006493.2:c.1054G>T137757493477574934GT256731Ceroid lipofuscinosis, neuronal, 5Newfoundland
CLN5NM_006493.2:c.1071_1072delCT137757495177574952CT-256731Ceroid lipofuscinosis, neuronal, 5Chinese/American
CLN5NM_006493.2:c.1072_1073delTT137757495277574953TT-256731Ceroid lipofuscinosis, neuronal, 5Pakistani; English
CLN5NM_006493.2:c.1083delT137757496377574963T-256731Ceroid lipofuscinosis, neuronal, 5American
CLN5NM_006493.2:c.1103_1106delAACA137757498377574986AACA-256731Ceroid lipofuscinosis, neuronal, 5American; Spanish
CLN5NM_006493.2:c.1103_1106delAACA137757498377574986AACA-256731Ceroid lipofuscinosis, neuronal, 5American; Spanish
CLN5NM_006493.2:c.1121A>G137757500177575001AG256731Ceroid lipofuscinosis, neuronal, 5American
CLN5NM_006493.2:c.1137G>T137757501777575017GT256731Ceroid lipofuscinosis, neuronal, 5Afganistan
CLN5NM_006493.2:c.1175_1176delAT137757505577575056AT-256731Ceroid lipofuscinosis, neuronal, 5Finnish
CLN5NM_006493.2:c.*33A>G137757513777575137AG256731Ceroid lipofuscinosis, neuronal, 5American
SLC7A7NM_001126105.2:c.500-4294_1908+1028del142324141923253554222700Lysinuric protein intoleranceSpanish
SLC7A7NM_001126105.2:c.771-848_1908+718del4647142324172923246375222700Lysinuric protein intoleranceSpanish
SLC7A7NM_001126105.2:c.1465T>C142324289023242890AG222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.1460delG142324289523242895C-222700Lysinuric protein intoleranceDutch; Norwegian
SLC7A7NM_001126105.2:c.1417C>T142324315423243154GA222700Lysinuric protein intoleranceAustralian
SLC7A7NM_001126105.2:c.1402C>T142324316923243169GA222700Lysinuric protein intoleranceGreek
SLC7A7NM_001126105.2:c.1387delG142324318423243184C-222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.1381_1384dupATCA142324318723243190TGATTGATTGAT222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.1371C>A142324320023243200GT222700Lysinuric protein intoleranceFrench-Algerian;Greek; Moroccan
SLC7A7NM_001126105.2:c.1344delC142324322723243227G-222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.1273T>C142324329823243298AG222700Lysinuric protein intoleranceSpanish
SLC7A7NM_001126105.2:c.1262delC142324330923243309G-222700Lysinuric protein intoleranceArab
SLC7A7NM_001126105.2:c.1228C>T142324358023243580GA222700Lysinuric protein intoleranceJapanese; Moroccan
SLC7A7NM_001126105.2:c.1185_1188delTTCT142324362023243623AGAA-222700Lysinuric protein intoleranceItalian;Tunisian;German;Spanish; French-Algerian
SLC7A7NM_001126105.2:c.1158C>A142324365023243650GT222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.1147_1152dupAACTA142324365623243661TAGTTTAGTTTAGTT222700Lysinuric protein intoleranceCanadian
SLC7A7NM_001126105.2:c.1093A>T142324465523244655TA222700Lysinuric protein intoleranceGerman
SLC7A7NM_001126105.2:c.1013G>A142324473523244735CT222700Lysinuric protein intoleranceSwedish
SLC7A7NM_001126105.2:c.1005_1008delCTTT142324474023244743AAAG-222700Lysinuric protein intoleranceSpanish; Japanese
SLC7A7NM_001126105.2:c.1001T>G142324474723244747AC222700Lysinuric protein intoleranceSpanish
SLC7A7NM_001126105.2:c.998+1G>T142324504123245041CA222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.998G>T142324504223245042CA222700Lysinuric protein intoleranceTurkish
SLC7A7NM_001126105.2:c.895-2A>T142324514723245147TA222700Lysinuric protein intoleranceFinnish
SLC7A7NM_001126105.2:c.895-2A>G142324514723245147TC222700Lysinuric protein intoleranceLithuanian
SLC7A7NM_001126105.2:c.894+1G>T142324540323245403CA222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.820dupT142324547823245478AAA222700Lysinuric protein intoleranceEnglish/Argentine
SLC7A7NM_001126105.2:c.782T>C142324551623245516AG222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.500-?_770+?del142324800223249260222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.500-?_770+?del142324800223249260222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.753G>T142324801923248019CA222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.726G>A142324804623248046CT222700Lysinuric protein intoleranceItalian;North African;Moroccan
SLC7A7NM_001126105.2:c.713C>T142324805923248059GA222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.625+1G>C142324913423249134CG222700Lysinuric protein intoleranceEnglish/Argentine
SLC7A7NM_001126105.2:c.625+1G>A142324913423249134CT222700Lysinuric protein intoleranceTurkish; Japanese
SLC7A7NM_001126105.2:c.500-?_625+?del142324913523249260222700Lysinuric protein intolerancePakistani
SLC7A7NM_001126105.2:c.622C>T142324913823249138GA222700Lysinuric protein intoleranceGerman
SLC7A7NM_001126105.2:c.571A>G142324918923249189TC222700Lysinuric protein intoleranceGerman
SLC7A7NM_001126105.2:c.563C>T142324919723249197GA222700Lysinuric protein intoleranceGreek
SLC7A7NM_001126105.2:c.545dupT142324921523249215AAA222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.499+1G>A142328210823282108CT222700Lysinuric protein intoleranceJapanese
SLC7A7NM_001126105.2:c.-44_499del142328210923284530222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.454T>C142328215423282154AG222700Lysinuric protein intoleranceGreek
SLC7A7NM_001126105.2:c.418G>C142328219023282190CG222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.371T>C142328223723282237AG222700Lysinuric protein intoleranceGreek
SLC7A7NM_001126105.2:c.254_255delTT142328235323282354AA-222700Lysinuric protein intoleranceTurkish
SLC7A7NM_001126105.2:c.215_218delCTCT142328239023282393AGAG-222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.161G>T142328244723282447CA222700Lysinuric protein intoleranceLatvian; Estonian
SLC7A7NM_001126105.2:c.158C>T142328245023282450GA222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.149T>A142328245923282459AT222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.105_107delGGA142328250123282503TCC-222700Lysinuric protein intoleranceGreek
SLC7A7NM_001126105.2:c.14C>T142328259423282594GA222700Lysinuric protein intoleranceItalian
SLC7A7NM_001126105.2:c.1A>C142328260723282607TG222700Lysinuric protein intoleranceItalian
AMNNM_030943.3:c.14delG14103389039103389039G-261100Megaloblastic anemia-1, Norwegian typeNorwegian
AMNNM_030943.3:c.43+1G>T14103389069103389069GT261100Megaloblastic anemia-1, Norwegian typeEnglish-Israeli
AMNNM_030943.3:c.122C>T14103390126103390126CT261100Megaloblastic anemia-1, Norwegian typeNorwegian
AMNNM_030943.3:c.208-2A>G14103394761103394761AG261100Megaloblastic anemia-1, Norwegian typeEastern Mediterranean
AMNNM_030943.3:c.208-1G>C14103394762103394762GC261100Megaloblastic anemia-1, Norwegian typeTurkish
AMNNM_030943.3:c.295delG14103394850103394850G-261100Megaloblastic anemia-1, Norwegian typeYemen
AMNNM_030943.3:c.468dupT14103395267103395267TTT261100Megaloblastic anemia-1, Norwegian typeFrench
AMNNM_030943.3:c.514-34G>A14103395424103395424GA261100Megaloblastic anemia-1, Norwegian typeTurkish
AMNNM_030943.3:c.663G>A14103395776103395776GA261100Megaloblastic anemia-1, Norwegian typeThai
AMNNM_030943.3:c.683_730del14103395796103395843261100Megaloblastic anemia-1, Norwegian typeAmerican
AMNNM_030943.3:c.701G>T14103395814103395814GT261100Megaloblastic anemia-1, Norwegian typeEnglish-Israeli
AMNNM_030943.3:c.742C>T14103395855103395855CT261100Megaloblastic anemia-1, Norwegian typeTurkish
AMNNM_030943.3:c.761G>A14103395992103395992GA261100Megaloblastic anemia-1, Norwegian typeTurkish
AMNNM_030943.3:c.967_1169+15del14103396384103396679261100Megaloblastic anemia-1, Norwegian typeCzech
AMNNM_030943.3:c.974_977dupCCCG14103396391103396394CCCGCCCGCCCG261100Megaloblastic anemia-1, Norwegian typeCzech
AMNNM_030943.3:c.1006+16_1006+30del14103396439103396453261100Megaloblastic anemia-1, Norwegian typeJemen
AMNNM_030943.3:c.1006+34_1006+48del14103396457103396471261100Megaloblastic anemia-1, Norwegian typeSpanish; French
AMNNM_030943.3:c.1006+36_1006+50del14103396459103396473261100Megaloblastic anemia-1, Norwegian typeBelgian
AMNNM_030943.3:c.1014_1021delCCTCGGCG14103396509103396516CCTCGGCG-261100Megaloblastic anemia-1, Norwegian typeGuatemalan/American; Guatemalan/Irish
AMNNM_030943.3:c.1170-6C>T14103396737103396737CT261100Megaloblastic anemia-1, Norwegian typeFinnish
AMNNM_030943.3:c.1253dupA14103396826103396826AAA261100Megaloblastic anemia-1, Norwegian typeBelgian
AMNNM_030943.3:c.1257+10C>T14103396840103396840CT261100Megaloblastic anemia-1, Norwegian typeMaroccan
AMNNM_030943.3:c.1314_1315delCA14103396969103396970CA-261100Megaloblastic anemia-1, Norwegian typeEuropean
CLN3NM_001042432.1:c.432+?_1350-?del162848880428498805204200Ceroid lipofuscinosis, neuronal, 3Moroccan
CLN3NM_001042432.1:c.678-?_1317+?del162848883728495439204200Ceroid lipofuscinosis, neuronal, 3Portugese
CLN3NM_001042432.1:c.1272delG162848888228488882C-204200Ceroid lipofuscinosis, neuronal, 3English
CLN3NM_001042432.1:c.1268C>A162848888628488886GT204200Ceroid lipofuscinosis, neuronal, 3Portugese
CLN3NM_001042432.1:c.1247A>G162848890728488907TC204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.1198-1G>T162848895728488957CA204200Ceroid lipofuscinosis, neuronal, 3American; English
CLN3NM_001042432.1:c.1195G>T162848906028489060CA204200Ceroid lipofuscinosis, neuronal, 3Argentine
CLN3NM_001042432.1:c.1056+?_1057-?del162848919828493426204200Ceroid lipofuscinosis, neuronal, 3Finnish
CLN3NM_001042432.1:c.791-802_1056+1445del2815162849198128494795204200Ceroid lipofuscinosis, neuronal, 3Finnish
CLN3NM_001042432.1:c.1056+3A>C162849342328493423TG204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.1056G>C162849342628493426CG204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.1056G>C162849342628493426CG204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.791-?_1056+?del162849342628493993204200Ceroid lipofuscinosis, neuronal, 3Finnish
CLN3NM_001042432.1:c.1054C>T162849342828493428GA204200Ceroid lipofuscinosis, neuronal, 3Dutch;American; French
CLN3NM_001042432.1:c.1048delC162849343428493434G-204200Ceroid lipofuscinosis, neuronal, 3Russian
CLN3NM_001042432.1:c.1001G>A162849348128493481CT204200Ceroid lipofuscinosis, neuronal, 3Finnish; Canadian
CLN3NM_001042432.1:c.1000C>T162849348228493482GA204200Ceroid lipofuscinosis, neuronal, 3Dutch; Argentine
CLN3NM_001042432.1:c.988G>T162849349428493494CA204200Ceroid lipofuscinosis, neuronal, 3Norwegian
CLN3NM_001042432.1:c.979C>T162849350328493503GA204200Ceroid lipofuscinosis, neuronal, 3Danish
CLN3NM_001042432.1:c.963-1G>T162849352028493520CA204200Ceroid lipofuscinosis, neuronal, 3English
CLN3NM_001042432.1:c.954_962+18del27162849363028493656204200Ceroid lipofuscinosis, neuronal, 3Swedish; Dutch
CLN3NM_001042432.1:c.944dupA162849366628493666TTT204200Ceroid lipofuscinosis, neuronal, 3Italian; American
CLN3NM_001042432.1:c.906+5G>A162849379328493793CT204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.883G>T162849382128493821CA204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.883G>A162849382128493821CT204200Ceroid lipofuscinosis, neuronal, 3German/Dutch;American; Finnish
CLN3NM_001042432.1:c.790+3A>C162849532428495324TG204200Ceroid lipofuscinosis, neuronal, 3Canadian
CLN3NM_001042432.1:c.461-280_677+382del162849728628498251204200Ceroid lipofuscinosis, neuronal, 3American;Argentine;Belgian;Brazilian;Canadian;Czech;Danish;Dutch;English;Finnish;French;German;German/Dutch;Icelandic;Irish;Italian;Newfoundland;Norwegian;Portugese;Russian;Spanish; Swedish
CLN3NM_001042432.1:c.631C>T162849771428497714GA204200Ceroid lipofuscinosis, neuronal, 3Italian
CLN3NM_001042432.1:c.622dupT162849772328497723AAA204200Ceroid lipofuscinosis, neuronal, 3Spanish
CLN3NM_001042432.1:c.597C>A162849774828497748GT204200Ceroid lipofuscinosis, neuronal, 3Lebanese; Italian
CLN3NM_001042432.1:c.586dupG162849775928497759CCC204200Ceroid lipofuscinosis, neuronal, 3English
CLN3NM_001042432.1:c.582G>T162849776328497763CA204200Ceroid lipofuscinosis, neuronal, 3Lebanese
CLN3NM_001042432.1:c.575G>A162849777028497770CT204200Ceroid lipofuscinosis, neuronal, 3Spanish
CLN3NM_001042432.1:c.569delG162849777628497776C-204200Ceroid lipofuscinosis, neuronal, 3Portugese
CLN3NM_001042432.1:c.565G>C162849778028497780CG204200Ceroid lipofuscinosis, neuronal, 3Portugese
CLN3NM_001042432.1:c.560G>C162849778528497785CG204200Ceroid lipofuscinosis, neuronal, 3Spanish; Dutch
CLN3NM_001042432.1:c.558_559delAG162849778628497787CT-204200Ceroid lipofuscinosis, neuronal, 3Italian
CLN3NM_001042432.1:c.533+1G>C162849789828497898CG204200Ceroid lipofuscinosis, neuronal, 3Finnish
CLN3NM_001042432.1:c.533+1G>A162849789828497898CT204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.509T>C162849792328497923AG204200Ceroid lipofuscinosis, neuronal, 3English
CLN3NM_001042432.1:c.485C>G162849794728497947GC204200Ceroid lipofuscinosis, neuronal, 3Danish
CLN3NM_001042432.1:c.482C>G162849795028497950GC204200Ceroid lipofuscinosis, neuronal, 3Swedish
CLN3NM_001042432.1:c.472G>C162849796028497960CG204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.461-1G>C162849797228497972CG204200Ceroid lipofuscinosis, neuronal, 3Canadian
CLN3NM_001042432.1:c.461-1G>A162849797228497972CT204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.461-13G>C162849798428497984CG204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.424delG162849881328498813C-204200Ceroid lipofuscinosis, neuronal, 3Dutch
CLN3NM_001042432.1:c.400T>C162849883728498837AG204200Ceroid lipofuscinosis, neuronal, 3Argentine
CLN3NM_001042432.1:c.379_380dupCC162849885728498858GGGGGG204200Ceroid lipofuscinosis, neuronal, 3English
CLN3NM_001042432.1:c.379delC162849885828498858G-204200Ceroid lipofuscinosis, neuronal, 3Russian
CLN3NM_001042432.1:c.374G>A162849898328498983CT204200Ceroid lipofuscinosis, neuronal, 3Spanish
CLN3NM_001042432.1:c.370dupT162849898728498987AAA204200Ceroid lipofuscinosis, neuronal, 3Spanish; American
CLN3NM_001042432.1:c.302T>C162849905528499055AG204200Ceroid lipofuscinosis, neuronal, 3Dutch
CLN3NM_001042432.1:c.265C>T162849994128499941GA204200Ceroid lipofuscinosis, neuronal, 3Spanish; Norwegian
CLN3NM_001042432.1:c.233_234insG162849997228499973GCGCC204200Ceroid lipofuscinosis, neuronal, 3Turkish
CLN3NM_001042432.1:c.222+5G>C162850060628500606CG204200Ceroid lipofuscinosis, neuronal, 3German
CLN3NM_001042432.1:c.222+2T>G162850060928500609AC204200Ceroid lipofuscinosis, neuronal, 3Greek
CLN3NM_001042432.1:c.214C>T162850061928500619GA204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.126-1G>A162850070828500708CT204200Ceroid lipofuscinosis, neuronal, 3Turkish
CLN3NM_001042432.1:c.125+5G>A162850279828502798CT204200Ceroid lipofuscinosis, neuronal, 3Belgian
CLN3NM_001042432.1:c.105G>A162850282328502823CT204200Ceroid lipofuscinosis, neuronal, 3German; American
CLN3NM_001042432.1:c.49G>T162850287928502879CA204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.49G>T162850287928502879CA204200Ceroid lipofuscinosis, neuronal, 3American
CLN3NM_001042432.1:c.1A>C162850308028503080TG204200Ceroid lipofuscinosis, neuronal, 3Dutch
RPGRIP1LNM_015272.2:c.3706C>T165363952253639522GA611561Meckel syndrome 5
RPGRIP1LNM_015272.2:c.2614C>T165367960653679606GA611561Meckel syndrome 5French
RPGRIP1LNM_015272.2:c.1829A>C165368677053686770TG611561Meckel syndrome 5English
RPGRIP1LNM_015272.2:c.1033C>T165370549253705492GA611561Meckel syndrome 5French
RPGRIP1LNM_015272.2:c.723_726delTGAA165372039553720398TTCA-611561Meckel syndrome 5English
RPGRIP1LNM_015272.2:c.394A>T165372611353726113TA611561Meckel syndrome 5Moroccan
GCSHNM_004483.4:c.425-1G>T168111656981116569CA605899Glycine encephalopathyAsian
B9D1NM_001243473.1:c.(?_-12)_(*381_+?)del171924647919266046614144Meckel syndrome 9American
B9D1NM_001243473.1:c.400+2T>C171925109519251095AG614144Meckel syndrome 9American
MKS1NM_017777.3:c.1490G>A175628382656283826CT249000Meckel syndrome 1French
MKS1NM_017777.3:c.1450_1453dupGGCA175628386356283866TGCCTGCCTGCC249000Meckel syndrome 1Pakistani
MKS1NM_017777.3:c.1408-35_1408-7del175628391556283943249000Meckel syndrome 1Finnish;African-American;American;Dutch;English;French;German;Italian;Irish-Portugese;Native American;Swedish
MKS1NM_017777.3:c.1407+2delT175628444456284444A-249000Meckel syndrome 1Turkish
MKS1NM_017777.3:c.1048C>T175628592156285921GA249000Meckel syndrome 1Palestinian
MKS1NM_017777.3:c.1048C>G175628592156285921GC249000Meckel syndrome 1Palestinian
MKS1NM_017777.3:c.1024+1G>A175628801956288019CT249000Meckel syndrome 1Caucasian-African-American
MKS1NM_017777.3:c.958G>A175628834156288341CT249000Meckel syndrome 1French
MKS1NM_017777.3:c.515+1G>A175629210156292101CT249000Meckel syndrome 1Kuwaiti
MKS1NM_017777.3:c.496C>T175629212156292121GA249000Meckel syndrome 1Finnish
MKS1NM_017777.3:c.472C>T175629214556292145GA249000Meckel syndrome 1French
MKS1NM_017777.3:c.424C>T175629219356292193GA249000Meckel syndrome 1French
MKS1NM_017777.3:c.417G>A175629344956293449CT249000Meckel syndrome 1Dutch;French; German
MKS1NM_017777.3:c.392_393delCT175629347356293474AG-249000Meckel syndrome 1Finnish
MKS1NM_017777.3:c.262-179_262-37del175629364156293783249000Meckel syndrome 1Turkish
MKS1NM_017777.3:c.184_190delACTGCCA175629598156295987TGGCAGTTGGCAGTTGGCAGT249000Meckel syndrome 1French
MKS1NM_017777.3:c.80+2T>C175629651056296510AG249000Meckel syndrome 1German
MKS1NM_017777.3:c.51_55dupCCGGG175629653756296541CCCGGCCCGGCCCGG249000Meckel syndrome 1German
TRIM37NM_015294.3:c.2212delG175710582157105821C-253250Mulibrey nanismFinnish
TRIM37NM_015294.3:c.2056C>T175710597757105977GA253250Mulibrey nanismSaudi Arab
TRIM37NM_015294.3:c.1894_1895delGA175710931057109311TC-253250Mulibrey nanismTurkish
TRIM37NM_015294.3:c.1314+507_1668-207del175711946657128068253250Mulibrey nanismSisilian
TRIM37NM_015294.3:c.1411C>T175712665857126658GA253250Mulibrey nanismCanadian; Tunisian-German
TRIM37NM_015294.3:c.1346dupA175712672357126723TTT253250Mulibrey nanismAmerican
TRIM37NM_015294.3:c.1037_1040dupAGAT175713439557134398ATCTATCTATCT253250Mulibrey nanismCanadian
TRIM37NM_015294.3:c.965G>T175713844757138447CA253250Mulibrey nanismCanadian
TRIM37NM_015294.3:c.860G>A175714171657141716CT253250Mulibrey nanismAustralian
TRIM37NM_015294.3:c.838_842delACTTT175714173457141738AAAGT-253250Mulibrey nanismCzech
TRIM37NM_015294.3:c.810-1G>A175714176757141767CT253250Mulibrey nanismTurkish
TRIM37NM_015294.3:c.745C>T175714824857148248GA253250Mulibrey nanismCanadian
TRIM37NM_015294.3:c.493-2A>G175715724057157240TC253250Mulibrey nanismFinnish
TRIM37NM_015294.3:c.326G>C175716140657161406CG253250Mulibrey nanismAustralian
TRIM37NM_015294.3:c.227T>C175716570657165706AG253250Mulibrey nanismFinnish
NPHS1NM_004646.3:c.3720_*9delGGTGTAAGAGCCCTCT193631740736317422AGAGGGCTCTTACACC-256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.3595-2A>G193631754936317549TC256300Nephrotic syndrome, type 1Hispanic
NPHS1NM_004646.3:c.3482G>T193632185836321858CA256300Nephrotic syndrome, type 1English
NPHS1NM_004646.3:c.3481+1G>T193632195436321954CA256300Nephrotic syndrome, type 1German
NPHS1NM_004646.3:c.3478C>T193632195836321958GA256300Nephrotic syndrome, type 1Maltese;Indian;Pakistani;Bangladeshi;European;Serbian;Asian;Arab; Italian
NPHS1NM_004646.3:c.3442C>T193632199436321994GA256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.3418C>T193632201836322018GA256300Nephrotic syndrome, type 1French; Amish
NPHS1NM_004646.3:c.3388-2A>G193632205036322050TC256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.3356_3357dupGG193632222836322229CCCCCC256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.3325C>T193632226036322260GA256300Nephrotic syndrome, type 1Finnish; Swedish
NPHS1NM_004646.3:c.3250delG193632258136322581C-256300Nephrotic syndrome, type 1North American/Mennonite
NPHS1NM_004646.3:c.3250dupG193632258136322581CCC256300Nephrotic syndrome, type 1Arab;Korean;Caucasian; Turkish
NPHS1NM_004646.3:c.3112-1A>T193632666236326662TA256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2944dupA193633030436330304TTT256300Nephrotic syndrome, type 1Indian
NPHS1NM_004646.3:c.2928G>T193633032036330320CA256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.2927+1G>A193633039736330397CT256300Nephrotic syndrome, type 1Romanian
NPHS1NM_004646.3:c.2816-4_2822delATAGGCCGCCC193633050336330513GGGCGGCCTAT-256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.2815+5G>A193633261236332612CT256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.2783C>A193633264936332649GT256300Nephrotic syndrome, type 1Chinese
NPHS1NM_004646.3:c.2769_2775delCAACGCC193633265736332663GGCGTTG-256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.2728T>C193633270436332704AG256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.2664-4_2670del193633276236332772256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.2625G>A193633306436333064CT256300Nephrotic syndrome, type 1Romanian; Chinese
NPHS1NM_004646.3:c.2618_2620delTCAinsCC193633306936333071TGAGG256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2606_2607dupCC193633308236333083GGGGGG256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.2596C>T193633309336333093GA256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.2548_2557delGCTGCAGCTG193633313236333141CAGCTGCAGC-256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.2515delC193633317436333174G-256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.2500G>T193633328736333287CA256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2495T>C193633329236333292AG256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2491C>T193633329636333296GA256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.2479C>T193633330836333308GA256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.2456A>T193633333136333331TA256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.2442C>G193633334536333345GC256300Nephrotic syndrome, type 1Korean
NPHS1NM_004646.3:c.2417C>A193633337036333370GT256300Nephrotic syndrome, type 1Moroccan
NPHS1NM_004646.3:c.2405G>C193633338236333382CG256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.2404C>T193633338336333383GA256300Nephrotic syndrome, type 1Dutch; Indian
NPHS1NM_004646.3:c.2335-1G>A193633345336333453CT256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.2227delC193633448136334481G-256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.2227C>T193633448136334481GA256300Nephrotic syndrome, type 1Finnish; English
NPHS1NM_004646.3:c.2225T>C193633448336334483AG256300Nephrotic syndrome, type 1Chinese
NPHS1NM_004646.3:c.2216C>T193633449236334492GA256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2172_2173delTG193633504436335045CA-256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2171C>G193633504636335046GC256300Nephrotic syndrome, type 1French
NPHS1NM_004646.3:c.2156_2163delTGCACTGC193633505436335061GCAGTGCA-256300Nephrotic syndrome, type 1Japanese; Korean
NPHS1NM_004646.3:c.2160_2161insC193633505636335057AGAGG256300Nephrotic syndrome, type 1Arab-Muslim
NPHS1NM_004646.3:c.2126T>G193633509136335091AC256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.2072-6C>G193633515136335151GC256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2071+2T>C193633521936335219AG256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.2043G>T193633524936335249CA256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.2019C>A193633527336335273GT256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.1954C>T193633533836335338GA256300Nephrotic syndrome, type 1Swedish
NPHS1NM_004646.3:c.1928T>C193633627236336272AG256300Nephrotic syndrome, type 1Indian
NPHS1NM_004646.3:c.1905C>T193633629536336295GA256300Nephrotic syndrome, type 1English
NPHS1NM_004646.3:c.1868G>T193633633236336332CA256300Nephrotic syndrome, type 1North American;English;Caucasian
NPHS1NM_004646.3:c.1829T>A193633637136336371AT256300Nephrotic syndrome, type 1French
NPHS1NM_004646.3:c.1801G>C193633639936336399CG256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.1759-15_1778del193633642236336456256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1760T>G193633644036336440AC256300Nephrotic syndrome, type 1Pakistani;Asian; Turkish
NPHS1NM_004646.3:c.1724C>A193633660436336604GT256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1715G>A193633661336336613CT256300Nephrotic syndrome, type 1Italian; European
NPHS1NM_004646.3:c.1707C>G193633662136336621GC256300Nephrotic syndrome, type 1European; Arab-Muslim
NPHS1NM_004646.3:c.1701C>A193633662736336627GT256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1672C>T193633665636336656GA256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.1583G>T193633695436336954CA256300Nephrotic syndrome, type 1French
NPHS1NM_004646.3:c.1555C>T193633698236336982GA256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.1481delC193633705636337056G-256300Nephrotic syndrome, type 1North American/Mennonite
NPHS1NM_004646.3:c.1394G>A193633898936338989CT256300Nephrotic syndrome, type 1Finnish
NPHS1NM_004646.3:c.1379G>A193633900436339004CT256300Nephrotic syndrome, type 1Caucasian;Hispanic;Japanese; Korean
NPHS1NM_004646.3:c.1339G>A193633904436339044CT256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.1337T>A193633904636339046AT256300Nephrotic syndrome, type 1English/Indian
NPHS1NM_004646.3:c.1307_1308dupAC193633916236339163GTGTGT256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.1292dupA193633917836339178TTT256300Nephrotic syndrome, type 1Middle Eastern
NPHS1NM_004646.3:c.1275delC193633919536339195G-256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.1250G>T193633922036339220CA256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1234G>T193633923636339236CA256300Nephrotic syndrome, type 1Caucasian
NPHS1NM_004646.3:c.1223G>A193633924736339247CT256300Nephrotic syndrome, type 1Finnish; European
NPHS1NM_004646.3:c.1219C>T193633925136339251GA256300Nephrotic syndrome, type 1Jordanian
NPHS1NM_004646.3:c.1138C>T193633957136339571GA256300Nephrotic syndrome, type 1Arab-Muslim
NPHS1NM_004646.3:c.1135_1136delCG193633957336339574CG-256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1135C>T193633957436339574GA256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.1134G>A193633957536339575CT256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.1126C>G193633958336339583GC256300Nephrotic syndrome, type 1Dutch
NPHS1NM_004646.3:c.1103C>T193633960636339606GA256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1102C>T193633960736339607GA256300Nephrotic syndrome, type 1Dutch
NPHS1NM_004646.3:c.1100G>A193633960936339609CT256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.1099C>T193633961036339610GA256300Nephrotic syndrome, type 1French
NPHS1NM_004646.3:c.1096A>C193633961336339613TG256300Nephrotic syndrome, type 1Croatian; Serbian
NPHS1NM_004646.3:c.1048T>C193633966136339661AG256300Nephrotic syndrome, type 1French; Romanian
NPHS1NM_004646.3:c.1040G>A193633966936339669CT256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.1019C>A193633969036339690GT256300Nephrotic syndrome, type 1Afganistan; Asian
NPHS1NM_004646.3:c.886G>A193634000436340004CT256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.808G>T193634017036340170CA256300Nephrotic syndrome, type 1English; English
NPHS1NM_004646.3:c.791C>G193634018736340187GC256300Nephrotic syndrome, type 1English/Indian
NPHS1NM_004646.3:c.766C>T193634021236340212GA256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.736G>T193634024236340242CA256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.692C>A193634047236340472GT256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.661_662delAG193634050236340503CT-256300Nephrotic syndrome, type 1English
NPHS1NM_004646.3:c.614_621delCACCCCGGinsTT193634054336340550CCGGGGTGAA256300Nephrotic syndrome, type 1Turkish; Caucasian
NPHS1NM_004646.3:c.609-2A>C193634055736340557TG256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.574C>T193634130036341300GA256300Nephrotic syndrome, type 1Arab
NPHS1NM_004646.3:c.534delG193634134036341340C-256300Nephrotic syndrome, type 1North American
NPHS1NM_004646.3:c.532C>T193634134236341342GA256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.526+5G>C193634185836341858CG256300Nephrotic syndrome, type 1Swedish
NPHS1NM_004646.3:c.518T>A193634187136341871AT256300Nephrotic syndrome, type 1French
NPHS1NM_004646.3:c.515_517delCCA193634187236341874TGG-256300Nephrotic syndrome, type 1Dutch; Egyptian
NPHS1NM_004646.3:c.516delC193634187336341873G-256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.512T>A193634187736341877AT256300Nephrotic syndrome, type 1Turkish
NPHS1NM_004646.3:c.500C>T193634188936341889GA256300Nephrotic syndrome, type 1Indian
NPHS1NM_004646.3:c.479G>C193634191036341910CG256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.468C>G193634192136341921GC256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.398-1G>A193634199236341992CT256300Nephrotic syndrome, type 1European
NPHS1NM_004646.3:c.320C>T193634224136342241GA256300Nephrotic syndrome, type 1Indian
NPHS1NM_004646.3:c.319G>A193634224236342242CT256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.313G>A193634224836342248CT256300Nephrotic syndrome, type 1Japanese
NPHS1NM_004646.3:c.286C>G193634227536342275GC256300Nephrotic syndrome, type 1
NPHS1NM_004646.3:c.248dupA193634238536342385TTT256300Nephrotic syndrome, type 1Italian
NPHS1NM_004646.3:c.191G>C193634244236342442CG256300Nephrotic syndrome, type 1Finnish
NPHS1NM_004646.3:c.139delG193634249436342494C-256300Nephrotic syndrome, type 1Hispanic; African-American
NPHS1NM_004646.3:c.121_122delCT193634251136342512AG-256300Nephrotic syndrome, type 1Finnish; Swedish
NPHS1NM_004646.3:c.58+1G>T193634268136342681CA256300Nephrotic syndrome, type 1Indian
NPHS1NM_004646.3:c.-340G>C193634307936343079CG256300Nephrotic syndrome, type 1English
NPHS1NM_004646.3:c.-469_-468delGA193634320736343208TC-256300Nephrotic syndrome, type 1North African
NPHS1NM_004646.3:c.-475_-468delGAGAGAGA193634320736343214TCTCTCTC-256300Nephrotic syndrome, type 1North American
TYROBPNM_003332.3:c.1-2900_277-1238del193639677436402030221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyFinnish; Brazilian
TYROBPNM_003332.3:c.262G>T193639813436398134CA221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyJapanese
TYROBPNM_003332.3:c.154_155ins42193639842236398423GTG(+ins42bp)T221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyScottish
TYROBPNM_003332.3:c.145G>C193639843236398432CG221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyPortugese
TYROBPNM_003332.3:c.141delG193639843636398436C-221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyJapanese
TYROBPNM_003332.3:c.116G>A193639846136398461CT221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyJapanese
TYROBPNM_003332.3:c.2T>C193639912936399129AG221770Polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathyJapanese
CSTBNM_000100.3:c.218_219delTC214519416145194162GA-254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)French; American
CSTBNM_000100.3:c.212A>C214519416845194168TG254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Dutch
CSTBNM_000100.3:c.202C>T214519417845194178GA254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Finnish; Dutch
CSTBNM_000100.3:c.169-2A>G214519421345194213TC254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)French
CSTBNM_000100.3:c.168G>A214519453945194539CT254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Japanese
CSTBNM_000100.3:c.125C>A214519458245194582GT254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Turkish
CSTBNM_000100.3:c.67-1G>C214519464145194641CG254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)American; European
CSTBNM_000100.3:c.66G>A214519608545196085CT254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Portugese
CSTBNM_000100.3:c.10G>C214519614145196141CG254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Moroccan
CSTBNM_000100.3:c.-210_-199(30_125)214519634945196360CCCGCCCCGCGC(CCCGCCCCGCGC)N30-125254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Finnish
AIRENM_000383.2:c.247A>G214570655445706554AG240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish
AIRENM_000383.2:c.769C>T214570965645709656CT240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish;American;British;Dutch;German;Italian;Swiss; Swedish
AIRENM_000383.2:c.932G>A214571103045711030GA240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish
AIRENM_000383.2:c.967_979del214571106545711077CTGTCCCCTCCGC-240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish;Dutch;German;British;Canadian;Italian; Swedish
AIRENM_000383.2:c.977C>A214571107545711075CA240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish
AIRENM_000383.2:c.1163_1164insA214571294345712944TGTAG240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish
AIRENM_000383.2:c.1638A>T214571761045717610AT240300Autoimmune polyendocrinopathy syndrome , type I, with or without reversible metaphyseal dysplasiaFinnish
RS1NM_000330.3:c.625C>GX1866017418660174GC312700RetinoschisisFinnish
RS1NM_000330.3:c.608C>TX1866019118660191GA312700RetinoschisisFinnish;French;Dutch;Greek;Portugese; Indian
RS1NM_000330.3:c.554C>AX1866024518660245GT312700RetinoschisisFinnish
RS1NM_000330.3:c.325G>CX1866531218665312CG312700RetinoschisisFinnish;French;German;British; American
RS1NM_000330.3:c.312C>GX1866532518665325GC312700RetinoschisisFinnish
RS1NM_000330.3:c.221G>TX1866541618665416CA312700RetinoschisisFinnish; Swedish
RS1NM_000330.3:c.214G>AX1866542318665423CT312700RetinoschisisFinnish;Danish;Dutch;Swedish;German;British;American;Japanese; Chinese
TRIM37NM_015294.3:c.2438_2439insAT175709310857093109CACATA253250Mulibrey nanismTurkish
TRIM37NM_015294.3:c.2125delA175710590857105908T-253250Mulibrey nanismPolish
TRIM37NM_015294.3:c.1999C>T175710603457106034GA253250Mulibrey nanismPolish
TRIM37NM_015294.3:c.1910_1911dupTA175710929457109295TATATA253250Mulibrey nanismSwiss
TRIM37NM_015294.3:c.1233delA175712865657128656T-253250Mulibrey nanismGerman
TRIM37NM_015294.3:c.1166A>G175713426957134269TC253250Mulibrey nanismFinnish
TRIM37NM_015294.3:c.685-?_809+?del175714818457148308253250Mulibrey nanismBritish
TRIM37NM_015294.3:c.81delG175718169657181696C-253250Mulibrey nanismFrench
CSTBNM_000100.3:c.168+1_168+18del214519452145194538254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Italian
CSTBNM_000100.3:c.149G>A214519455845194558CT254800Epilepsy, progressive myoclonic 1A (Unverricht and Lundborg)Finnish



FinDis has received funding from the Academy of Finland, Center of Excellence in Disease Genetics
and the European Community's Seventh Framework Programme (FP7/2007-2013) under grant agreement number 200754 - the GEN2PHEN project.